Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4732-3p URS00001A122A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4732: hsa-mir-4732 is a microRNA that has been identified in various studies. It has been found to bind to ORF-8 and is part of a 6-miRNA signature used to predict postoperative recurrence in patients with hepatocellular carcinoma (HCC) [PMC9160520] [PMC9664787]. hsa-mir-4732 has also been found to be related to non-small cell lung cancer (NSCLC) and has significant transcription disorders [PMC8294502]. It is one of the four miRNAs with the most differences in sensitivity and specificity, along with hsa-mir-30a, hsa-mir-338, and hsa-mir-451a [PMC8294502]. In addition, hsa-mir-4732 is part of a polycistronic gene along with hsa-miR-144 [PMC6191940]. It is also found in an interaction network that includes hsa-miR-449a, hsa-miR-142-3p, and hsa-miR1443p [PMC6191940]. Furthermore, studies have shown that it is downregulated in triple-negative breast cancer (TNBC) [PMC7499949] [PMC6521131]. Overall, the research suggests that hsa-mir-4732 plays a role in various diseases and may have potential diagnostic or therapeutic implications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCCUGACCUGUCCUGUUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications