Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Brachypodium distachyon (stiff brome) bdi-miR167c-5p URS00001A0A3D_15368

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAAGCUGCCAGCAUGAUCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Aegilops tauschii ata-miR167b-5p
  2. Asparagus officinalis aof-miR167b
  3. Carica papaya cpa-miR167d
  4. Citrus x clementina ccl-miR167b
  5. Citrus trifoliata ctr-miR167
  6. Cynara cardunculus var. scolymus cca-miR167e
  7. Eugenia uniflora eun-miR167a-5p
  8. Glycine max gma-miR167g
  9. Hordeum vulgare microRNA167h
  10. Manihot esculenta mes-miR167e
  11. Prunus persica (peach) ppe-miR167c
  12. Vriesea carinata vca-miR167a-5p
Publications