Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Citrus x clementina (clementine) ccl-miR167a URS00001A0A3D_85681

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAAGCUGCCAGCAUGAUCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Aegilops tauschii ata-miR167d-5p
  2. Asparagus officinalis aof-miR167b
  3. Brachypodium distachyon bdi-miR167c-5p
  4. Carica papaya cpa-miR167d
  5. Citrus trifoliata (trifoliate orange) ctr-miR167
  6. Cynara cardunculus var. scolymus cca-miR167e
  7. Eugenia uniflora (Brazil-cherry) eun-miR167a-5p
  8. Glycine max (soybean) gma-miR167g
  9. Hordeum vulgare microRNA167h
  10. Manihot esculenta mes-miR167f
  11. Prunus persica ppe-miR167c
  12. Vriesea carinata vca-miR167a-5p
Publications