Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays zma-miR164g-5p URS00001A00F8_4577

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Zea mays. Annotated by 3 databases (RefSeq, ENA, miRBase). Described in 4 papers. Zea mays zma-miR164g-5p sequence is a product of miR164b-5p, miR164c-5p, zma-miR164c, MIR164c, miR164c, zma-miR164g-5p, zma-miR164g, miR164g-5p, MIR164g, MIR164a, zma-miR164d-5p, zma-miR164a, zma-miR164b, zma-miR164b-5p, MIR164d, miR164a-5p, miR164, zma-miR164d, miR164d-5p, MIR164b, miR164a, zma-miR164a-5p, miR164g, zma-miR164c-5p, miR164b, miR164d genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGAGAAGCAGGGCACGUGCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 73 other species

    1. Aegilops tauschii ata-miR164b-5p
    2. Amborella trichopoda atr-miR164b
    3. Ananas comosus (pineapple) vvi-miR164c
    4. Arabidopsis lyrata aly-miR164b-5p
    5. Arabidopsis thaliana ath-miR164a
    6. Asparagus officinalis (garden asparagus) aof-miR164
    7. Brachypodium distachyon (stiff brome) bdi-miR164e
    8. Brassica napus bna-miR164a
    9. Brassica rapa (field mustard) bra-miR164a
    10. Cabomba aquatica miR164
    11. Camelina sativa (false flax) cas-miR164
    12. Carica papaya cpa-miR164a
    13. Citrus sinensis (sweet orange) csi-miR164d-5p
    14. Citrus trifoliata ctr-miR164
    15. Corchorus capsularis (jute) sRNA CCACVL1_09489
    16. Corchorus olitorius aly-miR164a-
    17. Cucumis melo cme-miR164d
    18. Cynara cardunculus var. scolymus cca-miR164b
    19. Fragaria vesca subsp. vesca fve-miR164a-5p
    20. Glycine max gma-miR164j
    21. Gossypium hirsutum (cotton) ghr-miR164
    22. Hevea brasiliensis (rubber tree) partial microRNA 164c
    23. Linum usitatissimum lus-miR164d
    24. Malus domestica (apple) mdm-miR164d
    25. Manihot esculenta (cassava) mes-miR164a
    26. Medicago truncatula mtr-miR164b
    27. Nicotiana tabacum nta-miR164b
    28. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR164b
    29. Oryza sativa osa-miR164a
    30. Populus tomentosa Pto-miR164d
    31. Populus tremula x Populus alba Pta-MIR164e
    32. Populus trichocarpa ptc-miR164d
    33. Prunus persica (peach) ppe-miR164c
    34. Ricinus communis (castor bean) rco-miR164a
    35. Rosa chinensis ath-miR164a
    36. Salvia sclarea ssl-miR164a
    37. Solanum lycopersicum sly-miR164a-5p
    38. Sorghum bicolor sbi-miR164d
    39. Theobroma cacao (cacao) tcc-miR164b
    40. Triticum aestivum tae-miR164
    41. Vitis vinifera (wine grape) vvi-miR164c