Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays zma-miR164b-5p URS00001A00F8_4577

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

zma-miR164a-5p: Zma-mir164a-5p is a type of microRNA that has been found to bind to the porcine target genes CSPG4, OTX1, and PLAGL2, suggesting that it can be absorbed from the diet and target specific genes [PMC7502231]. A dual-luciferase assay was performed to demonstrate the relationships between zma-mir164a-5p and these target genes [PMC5428504]. Through in silico analysis, 50 potential target porcine mRNAs for zma-mir164a-5p were predicted [PMC5428504]. Evidence from the miR-TRAP approach showed that zma-mir164a-5p can function similarly to endogenous miRNAs in porcine cells and target some of its predicted target genes in the Argonaute/RISC complex [PMC5428504]. The potential targeted mRNAs containing zma-mir164a-5p binding sites were synthesized for further analysis [PMC5428504]. qRT-PCR analysis revealed that 73.33% of the potential targets showed a significant increase in transcript levels, with 53.33% showing greater than 2-fold enrichment compared to control samples [PMC5428504]. The expression levels of zma-mir164a-5p and other maize-derived miRNAs were analyzed using qRT-PCR after feeding fresh maize to pigs, showing an increase in their abundance within 24 hours [PMC5428504]. Luciferase activity assays confirmed that zma-mir164a-5p significantly reduced luciferase activity for wild-type target genes but had no effect on mutant-type targets [PMC5428504]. TargetScan and NCBI Blast were used to predict potential target genes of zma-mir164a-5p in pigs, with their minimum free energy values evaluated by RNAhybrid [PMC5428504]. The Mir-TrAP System kit was used to identify specific microRNA targets in mammalian cells, including those targeted by zma-mir164a-5p [PMC5428504]. Additionally, zma-mir164a-5p was found to regulate six NAC genes [PMC9361504].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGAAGCAGGGCACGUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Aegilops tauschii ata-miR164c-5p
  2. Amborella trichopoda atr-miR164b
  3. Ananas comosus (pineapple) vvi-miR164c
  4. Arabidopsis lyrata aly-miR164a-5p
  5. Arabidopsis thaliana (thale cress) ath-miR164a
  6. Asparagus officinalis aof-miR164
  7. Brachypodium distachyon (stiff brome) bdi-miR164e
  8. Brassica napus bna-miR164a
  9. Brassica rapa bra-miR164a
  10. Cabomba aquatica miR164
  11. Camelina sativa (false flax) cas-miR164
  12. Carica papaya cpa-miR164c
  13. Citrus sinensis csi-miR164d-5p
  14. Citrus trifoliata ctr-miR164
  15. Corchorus capsularis sRNA CCACVL1_09489
  16. Corchorus olitorius aly-miR164a-
  17. Cucumis melo (muskmelon) cme-miR164c
  18. Cynara cardunculus var. scolymus cca-miR164b
  19. Fragaria vesca subsp. vesca fve-miR164a-5p
  20. Glycine max gma-miR164a
  21. Gossypium hirsutum (cotton) ghr-miR164
  22. Hevea brasiliensis partial microRNA 164c
  23. Linum usitatissimum (flax) lus-miR164d
  24. Malus domestica (apple) mdm-miR164d
  25. Manihot esculenta mes-miR164c
  26. Medicago truncatula (barrel medic) mtr-miR164a
  27. Nicotiana tabacum (common tobacco) nta-miR164a
  28. Oryza sativa Japonica Group microRNA osa-miR164b
  29. Oryza sativa (rice) osa-miR164a
  30. Populus deltoides pde-miR164e-5p
  31. Populus tomentosa Pto-miR164d
  32. Populus tremula x Populus alba Pta-MIR164e
  33. Populus trichocarpa ptc-miR164e
  34. Prunus persica (peach) ppe-miR164c
  35. Ricinus communis (castor bean) rco-miR164c
  36. Rosa chinensis ath-miR164a
  37. Salvia sclarea ssl-miR164b
  38. Solanum lycopersicum (tomato) sly-miR164b-5p
  39. Sorghum bicolor sbi-miR164e
  40. Theobroma cacao tcc-miR164a
  41. Triticum aestivum (bread wheat) tae-miR164
  42. Vitis vinifera vvi-miR164a
Publications