Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ananas comosus (pineapple) vvi-miR164c URS00001A00F8_4615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGAAGCAGGGCACGUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Aegilops tauschii ata-miR164c-5p
  2. Amborella trichopoda atr-miR164a
  3. Arabidopsis lyrata (lyrate rockcress) aly-miR164b-5p
  4. Arabidopsis thaliana (thale cress) ath-miR164b-5p
  5. Asparagus officinalis aof-miR164
  6. Brachypodium distachyon bdi-miR164e
  7. Brassica napus bna-miR164a
  8. Brassica rapa (field mustard) bra-miR164a
  9. Cabomba aquatica miR164
  10. Camelina sativa cas-miR164
  11. Carica papaya cpa-miR164c
  12. Citrus sinensis (sweet orange) csi-miR164a-5p
  13. Citrus trifoliata (trifoliate orange) ctr-miR164
  14. Corchorus capsularis sRNA CCACVL1_09489
  15. Corchorus olitorius aly-miR164a-
  16. Cucumis melo (muskmelon) cme-miR164d
  17. Cynara cardunculus var. scolymus cca-miR164b
  18. Fragaria vesca subsp. vesca fve-miR164b
  19. Glycine max (soybean) gma-miR164g
  20. Gossypium hirsutum ghr-miR164
  21. Hevea brasiliensis (rubber tree) partial microRNA 164c
  22. Linum usitatissimum lus-miR164b
  23. Malus domestica mdm-miR164f
  24. Manihot esculenta mes-miR164b
  25. Medicago truncatula mtr-miR164c
  26. Nicotiana tabacum (common tobacco) nta-miR164b
  27. Oryza sativa (Asian cultivated rice) osa-miR164a
  28. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR164b
  29. Populus deltoides pde-miR164e-5p
  30. Populus tomentosa Pto-miR164d
  31. Populus tremula x Populus alba Pta-MIR164e
  32. Populus trichocarpa (black cottonwood) ptc-miR164a
  33. Prunus persica ppe-miR164c
  34. Ricinus communis (castor bean) rco-miR164c
  35. Rosa chinensis ath-miR164a
  36. Salvia sclarea (clary) ssl-miR164a
  37. Solanum lycopersicum (tomato) sly-miR164b-5p
  38. Sorghum bicolor sbi-miR164a
  39. Theobroma cacao tcc-miR164a
  40. Triticum aestivum (bread wheat) tae-miR164
  41. Vitis vinifera (wine grape) vvi-miR164a
  42. Zea mays (maize) zma-miR164b-5p