Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Solanum lycopersicum (tomato) sly-miR164b-5p URS00001A00F8_4081

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

sly-miR164a-5p: Sly-mir164a-5p is a microRNA that was found to be down-regulated under treatment with Tomato chlorotic virus (ToCV) [PMC8258350]. In M82, sly-mir164a-5p was identified as a potential regulator of Lnc_000929, Lnc_000976, and Lnc_000530 [PMC9295719]. Additionally, sly-mir164a-5p was found to target genes encoding SPL, NAC, MYB, GRAS, and TCP transcription factors that are associated with plant stress tolerance [PMC5485680]. In tomato plants, a total of 29 miRNAs were identified to target polyamine transporter genes. Among them were sly-miR390a-5p, sly-miR390b-5p, and sly-miR6022 targeting Put1; sly-miR6024 and sly-miR6026 targeting Put2; sly-miR6023 and sly-miR1916 targeting Put3; and several miRNAs targeting Put4 (sly-miR9479-3p, sly-miR6024, sly-miR171c, etc.) [PMC9952195]. Furthermore, the interaction of sly-mir164a-5p with lncRNA XR_002027860.1 and mRNA XM_010327149.2 was observed [PMC6336255]. These findings highlight the potential role of sylmir164a-5p in regulating gene expression in tomato plants under various conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGAAGCAGGGCACGUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Aegilops tauschii ata-miR164c-5p
  2. Amborella trichopoda atr-miR164b
  3. Ananas comosus (pineapple) vvi-miR164c
  4. Arabidopsis lyrata aly-miR164a-5p
  5. Arabidopsis thaliana (thale cress) ath-miR164a
  6. Asparagus officinalis aof-miR164
  7. Brachypodium distachyon (stiff brome) bdi-miR164e
  8. Brassica napus bna-miR164a
  9. Brassica rapa bra-miR164a
  10. Cabomba aquatica miR164
  11. Camelina sativa (false flax) cas-miR164
  12. Carica papaya cpa-miR164c
  13. Citrus sinensis csi-miR164d-5p
  14. Citrus trifoliata ctr-miR164
  15. Corchorus capsularis sRNA CCACVL1_09489
  16. Corchorus olitorius aly-miR164a-
  17. Cucumis melo (muskmelon) cme-miR164c
  18. Cynara cardunculus var. scolymus cca-miR164b
  19. Fragaria vesca subsp. vesca fve-miR164a-5p
  20. Glycine max gma-miR164a
  21. Gossypium hirsutum (cotton) ghr-miR164
  22. Hevea brasiliensis partial microRNA 164c
  23. Linum usitatissimum (flax) lus-miR164d
  24. Malus domestica (apple) mdm-miR164d
  25. Manihot esculenta mes-miR164c
  26. Medicago truncatula (barrel medic) mtr-miR164a
  27. Nicotiana tabacum (common tobacco) nta-miR164a
  28. Oryza sativa Japonica Group microRNA osa-miR164b
  29. Oryza sativa (rice) osa-miR164a
  30. Populus deltoides pde-miR164e-5p
  31. Populus tomentosa Pto-miR164d
  32. Populus tremula x Populus alba Pta-MIR164e
  33. Populus trichocarpa ptc-miR164e
  34. Prunus persica (peach) ppe-miR164c
  35. Ricinus communis (castor bean) rco-miR164c
  36. Rosa chinensis ath-miR164a
  37. Salvia sclarea ssl-miR164b
  38. Sorghum bicolor sbi-miR164e
  39. Theobroma cacao tcc-miR164a
  40. Triticum aestivum (bread wheat) tae-miR164
  41. Vitis vinifera vvi-miR164a
  42. Zea mays zma-miR164b-5p
Publications