Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Glycine max (soybean) gma-miR164k URS00001A00F8_3847

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Glycine max. Annotated by 2 databases (RefSeq, miRBase). Glycine max (soybean) gma-miR164k sequence is a product of gma-miR164e, MIR164G, MIR164E, gma-miR164h, miR164e, miR164g, miR164f, MIR164K, miR164i, MIR164J, miR164a, MIR164F, MIR164A, gma-miR164i, miR164h, miR164k, MIR164H, gma-miR164f, miR164, MIR164I, gma-miR164a, gma-miR164g, gma-miR164j, miR164j, gma-miR164k genes. Found in the soybean reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGGAGAAGCAGGGCACGUGCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 41 other species

    1. Aegilops tauschii ata-miR164c-5p
    2. Amborella trichopoda atr-miR164a
    3. Ananas comosus (pineapple) vvi-miR164c
    4. Arabidopsis lyrata aly-miR164b-5p
    5. Arabidopsis thaliana ath-miR164a
    6. Asparagus officinalis (garden asparagus) aof-miR164
    7. Brachypodium distachyon (stiff brome) bdi-miR164b
    8. Brassica napus (rape) bna-miR164a
    9. Brassica rapa bra-miR164a
    10. Cabomba aquatica miR164
    11. Camelina sativa (false flax) cas-miR164
    12. Carica papaya (papaya) cpa-miR164b
    13. Citrus sinensis csi-miR164b-5p
    14. Citrus trifoliata ctr-miR164
    15. Corchorus capsularis sRNA CCACVL1_09489
    16. Corchorus olitorius aly-miR164a-
    17. Cucumis melo (muskmelon) cme-miR164c
    18. Cynara cardunculus var. scolymus cca-miR164b
    19. Fragaria vesca subsp. vesca fve-miR164b
    20. Gossypium hirsutum ghr-miR164
    21. Hevea brasiliensis (rubber tree) partial microRNA 164c
    22. Linum usitatissimum (flax) lus-miR164c
    23. Malus domestica mdm-miR164e
    24. Manihot esculenta (cassava) mes-miR164a
    25. Medicago truncatula (barrel medic) mtr-miR164a
    26. Nicotiana tabacum (common tobacco) nta-miR164b
    27. Oryza sativa Japonica Group microRNA osa-miR164b
    28. Oryza sativa (rice) osa-miR164a
    29. Populus tomentosa Pto-miR164d
    30. Populus tremula x Populus alba Pta-MIR164e
    31. Populus trichocarpa ptc-miR164e
    32. Prunus persica (peach) ppe-miR164c
    33. Ricinus communis (castor bean) rco-miR164b
    34. Rosa chinensis ath-miR164a
    35. Salvia sclarea ssl-miR164b
    36. Solanum lycopersicum sly-miR164a-5p
    37. Sorghum bicolor (sorghum) sbi-miR164a
    38. Theobroma cacao tcc-miR164a
    39. Triticum aestivum tae-miR164
    40. Vitis vinifera vvi-miR164a
    41. Zea mays zma-miR164a-5p
    Publications New