Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Brassica rapa (field mustard) bra-miR164a URS00001A00F8_3711

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGAAGCAGGGCACGUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Aegilops tauschii ata-miR164c-5p
  2. Amborella trichopoda atr-miR164b
  3. Ananas comosus (pineapple) vvi-miR164c
  4. Arabidopsis lyrata aly-miR164a-5p
  5. Arabidopsis thaliana (thale cress) ath-miR164a
  6. Asparagus officinalis aof-miR164
  7. Brachypodium distachyon (stiff brome) bdi-miR164e
  8. Brassica napus bna-miR164a
  9. Cabomba aquatica miR164
  10. Camelina sativa (false flax) cas-miR164
  11. Carica papaya cpa-miR164c
  12. Citrus sinensis csi-miR164d-5p
  13. Citrus trifoliata ctr-miR164
  14. Corchorus capsularis sRNA CCACVL1_09489
  15. Corchorus olitorius aly-miR164a-
  16. Cucumis melo (muskmelon) cme-miR164c
  17. Cynara cardunculus var. scolymus cca-miR164b
  18. Fragaria vesca subsp. vesca fve-miR164a-5p
  19. Glycine max gma-miR164a
  20. Gossypium hirsutum (cotton) ghr-miR164
  21. Hevea brasiliensis partial microRNA 164c
  22. Linum usitatissimum (flax) lus-miR164d
  23. Malus domestica (apple) mdm-miR164d
  24. Manihot esculenta mes-miR164c
  25. Medicago truncatula (barrel medic) mtr-miR164a
  26. Nicotiana tabacum (common tobacco) nta-miR164a
  27. Oryza sativa Japonica Group microRNA osa-miR164b
  28. Oryza sativa (rice) osa-miR164a
  29. Populus deltoides pde-miR164e-5p
  30. Populus tomentosa Pto-miR164d
  31. Populus tremula x Populus alba Pta-MIR164e
  32. Populus trichocarpa ptc-miR164e
  33. Prunus persica (peach) ppe-miR164c
  34. Ricinus communis (castor bean) rco-miR164c
  35. Rosa chinensis ath-miR164a
  36. Salvia sclarea ssl-miR164b
  37. Solanum lycopersicum (tomato) sly-miR164b-5p
  38. Sorghum bicolor sbi-miR164e
  39. Theobroma cacao tcc-miR164a
  40. Triticum aestivum (bread wheat) tae-miR164
  41. Vitis vinifera vvi-miR164a
  42. Zea mays zma-miR164b-5p
Publications