Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Populus trichocarpa (black cottonwood) ptc-miR164e URS00001A00F8_3694

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Populus trichocarpa. Annotated by 2 databases (ENA, miRBase). Populus trichocarpa (black cottonwood) ptc-miR164e sequence is a product of MIR164, miR164, ptr-MIR164a, ptc-miR164a, miR164a, ptr-MIR164e, MIR164a, miR164d, ptc-miR164d, MIR164b, ptc-miR164c, ptr-MIR164c, miR164e, ptc-miR164e, MIR164e, ptr-MIR164b, MIR164c, miR164c genes. Found in the black cottonwood reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGGAGAAGCAGGGCACGUGCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 41 other species

    1. Aegilops tauschii ata-miR164c-5p
    2. Amborella trichopoda atr-miR164a
    3. Ananas comosus (pineapple) vvi-miR164c
    4. Arabidopsis lyrata aly-miR164b-5p
    5. Arabidopsis thaliana ath-miR164a
    6. Asparagus officinalis (garden asparagus) aof-miR164
    7. Brachypodium distachyon (stiff brome) bdi-miR164b
    8. Brassica napus (rape) bna-miR164a
    9. Brassica rapa bra-miR164a
    10. Cabomba aquatica miR164
    11. Camelina sativa (false flax) cas-miR164
    12. Carica papaya (papaya) cpa-miR164b
    13. Citrus sinensis csi-miR164b-5p
    14. Citrus trifoliata ctr-miR164
    15. Corchorus capsularis sRNA CCACVL1_09489
    16. Corchorus olitorius aly-miR164a-
    17. Cucumis melo (muskmelon) cme-miR164c
    18. Cynara cardunculus var. scolymus cca-miR164b
    19. Fragaria vesca subsp. vesca fve-miR164b
    20. Glycine max gma-miR164k
    21. Gossypium hirsutum ghr-miR164
    22. Hevea brasiliensis (rubber tree) partial microRNA 164c
    23. Linum usitatissimum (flax) lus-miR164c
    24. Malus domestica mdm-miR164e
    25. Manihot esculenta (cassava) mes-miR164a
    26. Medicago truncatula (barrel medic) mtr-miR164a
    27. Nicotiana tabacum (common tobacco) nta-miR164b
    28. Oryza sativa Japonica Group microRNA osa-miR164b
    29. Oryza sativa (rice) osa-miR164a
    30. Populus tomentosa Pto-miR164d
    31. Populus tremula x Populus alba Pta-MIR164e
    32. Prunus persica (peach) ppe-miR164c
    33. Ricinus communis (castor bean) rco-miR164b
    34. Rosa chinensis ath-miR164a
    35. Salvia sclarea ssl-miR164b
    36. Solanum lycopersicum sly-miR164a-5p
    37. Sorghum bicolor (sorghum) sbi-miR164a
    38. Theobroma cacao tcc-miR164a
    39. Triticum aestivum tae-miR164
    40. Vitis vinifera vvi-miR164a
    41. Zea mays zma-miR164a-5p
    Publications New