Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-278-3p URS000019E005_7091

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bmo-mir-278: Bmo-mir-278 is an MLS-biased miRNA that was found at MLS [PMC2500172]. Its homolog, dme-miR-278, has been shown to control energy homeostasis in Drosophila, as miR-278 mutants exhibit elevated insulin production and elevated circulating sugar [PMC2500172]. Bmo-mir-278, along with four highly-conserved miRNAs (bmo-miR-306, bmo-miR-317, and bmo-miR-768) and three less-conserved miRNAs (bmo-miR-1920, bmo-miR-1921, and bmo-miR-1922), were cloned directly despite not being predicted based on the researchers' criteria [PMC2500172]. Several pre-miRNAs were not detected initially due to the stringency of the filters but were discovered through direct cloning experiments [PMC2500172]. Bmo-mir-278 has a relatively high expression level and may play a role in regulating energy metabolism at the molting stage by targeting insulin receptor-like protein precursor (BIR), bombyxin, and BmCF1 [PMC2500172]. The expression of bmo-mir-278 increases at MLS (p = 0.022), late fifth-instar larva (LFLS) (p = 0.048), PPS (p = 0.042), DS (p = 0.0083), SS (p = 0.012), and PS (p = 0.022) [PMC2500172]. The literature-based and database collections of miRNAs such as bmo-bantam, bmo-miR-12, bmo-miR263a/b showed weaker signals compared to the miRNAs collected from miRBase [PMC4045974].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGUGGGAUCUUCGUCCGUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Heliconius melpomene hme-miR-278
  2. Manduca sexta mse-miR-278
Publications