Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-26a-2-5p URS000019B0F7_9031

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAAGUAAUCCAGGAUAGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 68 other species

  1. Alligator mississippiensis (American alligator) ami-miR-26-5p
  2. Anolis carolinensis aca-miR-26-3-5p
  3. Bos taurus bta-miR-26a
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-26a
  5. Callorhinchus milii (elephant shark) Cmi-Mir-26-P1_5p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-26a
  7. Capra hircus (goat) chi-miR-26a-5p
  8. Cavia porcellus (domestic guinea pig) cpo-miR-26a-5p
  9. Cervus elaphus cel-miR-26a
  10. Chiloscyllium plagiosum microRNA cpl-miR-26
  11. Chrysemys picta bellii Cpi-Mir-26-P1_5p (mature (guide))
  12. Chrysemys picta cpi-miR-26-5p
  13. Columba livia (rock pigeon) cli-miR-26-5p
  14. Cyprinus carpio (common carp) ccr-miR-26a
  15. Danio rerio dre-miR-26a-5p
  16. Dasypus novemcinctus dno-miR-26a-5p
  17. Daubentonia madagascariensis (aye-aye) dma-miR-26a
  18. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-26-P1_5p (mature (guide))
  19. Eptatretus burgeri (inshore hagfish) Ebu-Mir-26-P5_5p (mature (guide))
  20. Equus caballus eca-miR-26a
  21. Gadus morhua (Atlantic cod) gmo-miR-26a-5p
  22. Gekko japonicus Gja-Mir-26-P1_5p (mature (guide))
  23. Gorilla gorilla gorilla ggo-miR-26a (MIR26A)
  24. Gorilla gorilla (western gorilla) ggo-miR-26a
  25. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-26a
  26. Homo sapiens hsa-miR-26a-5p
  27. Ictalurus punctatus (channel catfish) ipu-miR-26a
  28. Lagothrix lagotricha (brown woolly monkey) lla-miR-26a
  29. Latimeria chalumnae (coelacanth) Lch-Mir-26-P4_5p (mature (guide))
  30. Lepisosteus oculatus Loc-Mir-26-P1_5p (mature (guide))
  31. Macaca mulatta (Rhesus monkey) mml-miR-26a-5p
  32. Macaca nemestrina mne-miR-26a
  33. Maylandia zebra mze-miR-26a
  34. Microcaecilia unicolor Mun-Mir-26-P4_5p (mature (guide))
  35. Microcebus murinus (gray mouse lemur) mmr-miR-26a
  36. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-26-P1_5p (mature (guide))
  37. Monopterus albus Mal-Mir-26-P1b_5p (mature (guide))
  38. Mus musculus mmu-miR-26a-5p
  39. Neolamprologus brichardi nbr-miR-26a
  40. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-26a
  41. Ophiophagus hannah oha-miR-26-5p
  42. Oreochromis niloticus oni-miR-26a
  43. Ornithorhynchus anatinus oan-miR-26-5p
  44. Oryctolagus cuniculus ocu-miR-26a-5p
  45. Otolemur garnettii oga-miR-26a
  46. Ovis aries oar-miR-26a
  47. Pan paniscus ppa-miR-26a
  48. Pan troglodytes ptr-miR-26a
  49. Papio hamadryas pha-miR-26a
  50. Petromyzon marinus (sea lamprey) pma-miR-26a-5p
  51. Pongo pygmaeus ppy-miR-26a
  52. Pteropus alecto (black flying fox) pal-miR-26a-5p
  53. Pundamilia nyererei pny-miR-26a
  54. Python bivittatus pbv-miR-26-5p
  55. Rattus norvegicus rno-miR-26a-5p
  56. Saimiri boliviensis boliviensis sbo-miR-26a
  57. Salmo salar ssa-miR-26a-5p
  58. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-26-P1_5p (mature (guide))
  59. Scyliorhinus torazame Sto-Mir-26-P1_5p (mature (guide))
  60. Sphenodon punctatus Spt-Mir-26-P1_5p (mature (guide))
  61. Sus scrofa (pig) ssc-miR-26a
  62. Taeniopygia guttata (zebra finch) tgu-miR-26-5p
  63. Takifugu rubripes (torafugu) fru-miR-26
  64. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-26
  65. Tor tambroides (Thai mahseer) miR-26a-5p
  66. Tupaia chinensis tch-miR-26a-5p
  67. Xenopus laevis (African clawed frog) xla-miR-26-5p
  68. Xenopus tropicalis Xtr-Mir-26-P1_5p (mature (guide))
Publications