Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-26a-5p URS000019B0F7_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 4 databases (RefSeq, ENA, MirGeneDB, miRBase). Described in 17 papers. Danio rerio (zebrafish) dre-miR-26a-5p sequence is a product of miR-26a-5p, dre-miR-26a, miR-26, mir26a-1, miR-26a, mir26a-3, dre-miR-26a-5p, mir26a-2 genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUCAAGUAAUCCAGGAUAGGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 146 other species

    1. Alligator mississippiensis ami-miR-26-5p
    2. Anolis carolinensis aca-miR-26-3-5p
    3. Bos taurus (cattle) bta-miR-26a
    4. Callithrix jacchus cja-miR-26a
    5. Canis lupus familiaris cfa-miR-26a
    6. Capra hircus chi-miR-26a-5p
    7. Cavia porcellus (domestic guinea pig) cpo-miR-26a-5p
    8. Cervus elaphus (red deer) cel-miR-26a
    9. Chiloscyllium plagiosum microRNA cpl-miR-26
    10. Chrysemys picta bellii Cpi-Mir-26-P1_5p (mature (guide))
    11. Chrysemys picta (Painted turtle) cpi-miR-26-5p
    12. Columba livia (rock pigeon) cli-miR-26-5p
    13. Cyprinus carpio ccr-miR-26a
    14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-26a-5p
    15. Daubentonia madagascariensis (aye-aye) dma-miR-26a
    16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-26-P3_5p (mature (guide))
    17. Equus caballus (horse) eca-miR-26a
    18. Gadus morhua gmo-miR-26a-5p
    19. Gallus gallus (chicken) gga-miR-26a-2-5p
    20. Gorilla gorilla (western gorilla) ggo-miR-26a
    21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-26a
    22. Homo sapiens hsa-miR-26a-5p
    23. Ictalurus punctatus (channel catfish) ipu-miR-26a
    24. Lagothrix lagotricha lla-miR-26a
    25. Macaca mulatta mml-miR-26a-5p
    26. Macaca nemestrina (pig-tailed macaque) mne-miR-26a
    27. Maylandia zebra mze-miR-26a
    28. Microcebus murinus mmr-miR-26a
    29. Monodelphis domestica Mdo-Mir-26-P1_5p (mature (guide))
    30. Mus musculus (house mouse) mmu-miR-26a-5p
    31. Neolamprologus brichardi nbr-miR-26a
    32. Nomascus leucogenys nle-miR-26a
    33. Ophiophagus hannah oha-miR-26-5p
    34. Oreochromis niloticus oni-miR-26a
    35. Ornithorhynchus anatinus oan-miR-26-5p
    36. Oryctolagus cuniculus (rabbit) ocu-miR-26a-5p
    37. Otolemur garnettii oga-miR-26a
    38. Ovis aries oar-miR-26a
    39. Pan paniscus ppa-miR-26a
    40. Pan troglodytes (chimpanzee) ptr-miR-26a
    41. Papio hamadryas (hamadryas baboon) pha-miR-26a
    42. Petromyzon marinus pma-miR-26a-5p
    43. Pongo pygmaeus ppy-miR-26a
    44. Pteropus alecto pal-miR-26a-5p
    45. Pundamilia nyererei pny-miR-26a
    46. Python bivittatus pbv-miR-26-5p
    47. Rattus norvegicus rno-miR-26a-5p
    48. Saimiri boliviensis boliviensis sbo-miR-26a
    49. Salmo salar (Atlantic salmon) ssa-miR-26a-5p
    50. Sarcophilus harrisii Sha-Mir-26-P1_5p (mature (guide))
    51. Scyliorhinus torazame (cloudy catshark) Sto-Mir-26-P1_5p (mature (guide))
    52. Sus scrofa ssc-miR-26a
    53. Taeniopygia guttata (zebra finch) tgu-miR-26-5p
    54. Takifugu rubripes (torafugu) fru-miR-26
    55. Tetraodon nigroviridis tni-miR-26
    56. Tor tambroides miR-26a-5p
    57. Tupaia chinensis tch-miR-26a-5p
    58. Xenopus laevis (African clawed frog) xla-miR-26-5p
    59. Xenopus tropicalis Xtr-Mir-26-P1b_5p (mature (guide))