Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Taeniopygia guttata (zebra finch) tgu-miR-26-5p URS000019B0F7_59729

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAAGUAAUCCAGGAUAGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 68 other species

  1. Alligator mississippiensis (American alligator) ami-miR-26-5p
  2. Anolis carolinensis aca-miR-26-3-5p
  3. Bos taurus bta-miR-26a
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-26a
  5. Callorhinchus milii (elephant shark) Cmi-Mir-26-P1_5p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-26a
  7. Capra hircus (goat) chi-miR-26a-5p
  8. Cavia porcellus (domestic guinea pig) cpo-miR-26a-5p
  9. Cervus elaphus cel-miR-26a
  10. Chiloscyllium plagiosum microRNA cpl-miR-26
  11. Chrysemys picta bellii Cpi-Mir-26-P1_5p (mature (guide))
  12. Chrysemys picta cpi-miR-26-5p
  13. Columba livia (rock pigeon) cli-miR-26-5p
  14. Cyprinus carpio (common carp) ccr-miR-26a
  15. Danio rerio dre-miR-26a-5p
  16. Dasypus novemcinctus dno-miR-26a-5p
  17. Daubentonia madagascariensis (aye-aye) dma-miR-26a
  18. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-26-P1_5p (mature (guide))
  19. Eptatretus burgeri (inshore hagfish) Ebu-Mir-26-P5_5p (mature (guide))
  20. Equus caballus eca-miR-26a
  21. Gadus morhua (Atlantic cod) gmo-miR-26a-5p
  22. Gallus gallus (chicken) gga-miR-26a-2-5p
  23. Gekko japonicus Gja-Mir-26-P1_5p (mature (guide))
  24. Gorilla gorilla gorilla ggo-miR-26a (MIR26A)
  25. Gorilla gorilla (western gorilla) ggo-miR-26a
  26. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-26a
  27. Homo sapiens hsa-miR-26a-5p
  28. Ictalurus punctatus (channel catfish) ipu-miR-26a
  29. Lagothrix lagotricha (brown woolly monkey) lla-miR-26a
  30. Latimeria chalumnae (coelacanth) Lch-Mir-26-P4_5p (mature (guide))
  31. Lepisosteus oculatus Loc-Mir-26-P1_5p (mature (guide))
  32. Macaca mulatta (Rhesus monkey) mml-miR-26a-5p
  33. Macaca nemestrina mne-miR-26a
  34. Maylandia zebra mze-miR-26a
  35. Microcaecilia unicolor Mun-Mir-26-P4_5p (mature (guide))
  36. Microcebus murinus (gray mouse lemur) mmr-miR-26a
  37. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-26-P1_5p (mature (guide))
  38. Monopterus albus Mal-Mir-26-P1b_5p (mature (guide))
  39. Mus musculus mmu-miR-26a-5p
  40. Neolamprologus brichardi nbr-miR-26a
  41. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-26a
  42. Ophiophagus hannah oha-miR-26-5p
  43. Oreochromis niloticus oni-miR-26a
  44. Ornithorhynchus anatinus oan-miR-26-5p
  45. Oryctolagus cuniculus ocu-miR-26a-5p
  46. Otolemur garnettii oga-miR-26a
  47. Ovis aries oar-miR-26a
  48. Pan paniscus ppa-miR-26a
  49. Pan troglodytes ptr-miR-26a
  50. Papio hamadryas pha-miR-26a
  51. Petromyzon marinus (sea lamprey) pma-miR-26a-5p
  52. Pongo pygmaeus ppy-miR-26a
  53. Pteropus alecto (black flying fox) pal-miR-26a-5p
  54. Pundamilia nyererei pny-miR-26a
  55. Python bivittatus pbv-miR-26-5p
  56. Rattus norvegicus rno-miR-26a-5p
  57. Saimiri boliviensis boliviensis sbo-miR-26a
  58. Salmo salar ssa-miR-26a-5p
  59. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-26-P1_5p (mature (guide))
  60. Scyliorhinus torazame Sto-Mir-26-P1_5p (mature (guide))
  61. Sphenodon punctatus Spt-Mir-26-P1_5p (mature (guide))
  62. Sus scrofa (pig) ssc-miR-26a
  63. Takifugu rubripes (torafugu) fru-miR-26
  64. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-26
  65. Tor tambroides (Thai mahseer) miR-26a-5p
  66. Tupaia chinensis tch-miR-26a-5p
  67. Xenopus laevis (African clawed frog) xla-miR-26-5p
  68. Xenopus tropicalis Xtr-Mir-26-P1_5p (mature (guide))