Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-30c URS000019907A_9913

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCUACACUCUCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 30 other species

  1. Alligator mississippiensis (American alligator) ami-miR-30c-5p
  2. Anolis carolinensis aca-miR-30c-5p
  3. Callorhinchus milii (elephant shark) eshark_mir-30_4
  4. Capra hircus (goat) chi-miR-30c-5p
  5. Cricetulus griseus cgr-miR-30c-2
  6. Equus caballus eca-miR-30c
  7. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-8947
  8. Gorilla gorilla gorilla ggo-miR-30c (MIR30C)
  9. Gorilla gorilla (western gorilla) ggo-miR-30c
  10. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-30b
  11. Homo sapiens hsa-miR-30c-5p
  12. Lagothrix lagotricha (brown woolly monkey) lla-miR-30c
  13. Macaca mulatta (Rhesus monkey) mml-miR-30c-5p
  14. Macaca nemestrina mne-miR-30c
  15. Microcebus murinus (gray mouse lemur) mmr-miR-30c
  16. Monodelphis domestica (gray short-tailed opossum) mdo-miR-30c-5p
  17. Mus musculus mmu-miR-30c-5p
  18. Ornithorhynchus anatinus oan-miR-30c-5p
  19. Oryzias latipes (Japanese medaka) ola-miR-30c
  20. Otolemur garnettii oga-miR-30c
  21. Ovis aries miscellaneous RNA
  22. Pan troglodytes ptr-miR-30c
  23. Papio hamadryas pha-miR-30c
  24. Pongo pygmaeus ppy-miR-30c
  25. Rattus norvegicus rno-miR-30c-5p
  26. Salmo salar ssa-miR-30a-5p
  27. Sus scrofa (pig) ssc-miR-30c-5p
  28. Tupaia chinensis tch-miR-30c-5p
  29. Tursiops truncatus miR-30c-5p
  30. Xenopus tropicalis xtr-miR-30c
Publications