v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Anolis carolinensis (green anole) aca-miR-30c-5p URS000019907A_28377

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGUAAACAUCCUACACUCUCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 30 other species

  1. Alligator mississippiensis (American alligator) ami-miR-30c-5p
  2. Bos taurus (domestic cattle) bta-miR-30c
  3. Callorhinchus milii (elephant shark) eshark_mir-30_4
  4. Capra hircus chi-miR-30c-5p
  5. Cricetulus griseus (Chinese hamster) cgr-miR-30c-2
  6. Equus caballus eca-miR-30c
  7. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-8947
  8. Gorilla gorilla gorilla ggo-miR-30c (MIR30C)
  9. Gorilla gorilla ggo-miR-30c
  10. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-30b
  11. Homo sapiens (human) hsa-miR-30c-5p
  12. Lagothrix lagotricha (brown woolly monkey) lla-miR-30c
  13. Macaca mulatta (Rhesus monkey) mml-miR-30c-5p
  14. Macaca nemestrina (pig-tailed macaque) mne-miR-30c
  15. Microcebus murinus mmr-miR-30c
  16. Monodelphis domestica mdo-miR-30c-5p
  17. Mus musculus (house mouse) mmu-miR-30c-5p
  18. Ornithorhynchus anatinus oan-miR-30c-5p
  19. Oryzias latipes ola-miR-30c
  20. Otolemur garnettii (small-eared galago) oga-miR-30c
  21. Ovis aries miscellaneous RNA
  22. Pan troglodytes ptr-miR-30c
  23. Papio hamadryas pha-miR-30c
  24. Pongo pygmaeus (Bornean orangutan) ppy-miR-30c
  25. Rattus norvegicus (Norway rat) rno-miR-30c-5p
  26. Salmo salar (Atlantic salmon) ssa-miR-30a-5p
  27. Sus scrofa (pig) ssc-miR-30c-5p
  28. Tupaia chinensis tch-miR-30c-5p
  29. Tursiops truncatus miR-30c-5p
  30. Xenopus tropicalis xtr-miR-30c
 Relationships New

Molecular Relationships

 Publications