Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-30c-5p URS000019907A_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (ENA, PSICQUIC, RefSeq, LncBase, GeneCards, MalaCards, TarBase, miRBase). Described in 93 papers. Homo sapiens (human) hsa-miR-30c-5p sequence is a product of miR-30c, MIR30C2, hsa-miR-30c, miR-30, MIR30C1, hsa-miR-30c-5p, miR-30c-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3, 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 182-FIP, 1A1-3B, 1R20, 2C4D, 2HOR0202, 3'HEXO.

Interactions 5

According to PSICQUIC, Homo sapiens (human) hsa-miR-30c-5p interacts with:

Interaction id Participant Synonyms
URS000019907A_9606-0 O60706 O60706
URS000019907A_9606-1 P55157 P55157
URS000019907A_9606-2 P55157 P55157
URS000019907A_9606-3 P55157 P55157
URS000019907A_9606-4 P55157 P55157

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUAAACAUCCUACACUCUCAGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 62 other species

    1. Alligator mississippiensis ami-miR-30c-5p
    2. Anolis carolinensis aca-miR-30c-5p
    3. Bos taurus (cattle) bta-miR-30c
    4. Callorhinchus milii (elephant shark) eshark_mir-30_4
    5. Capra hircus chi-miR-30c-5p
    6. Cricetulus griseus cgr-miR-30c-2
    7. Equus caballus (horse) eca-miR-30c
    8. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-8947
    9. Gorilla gorilla (western gorilla) ggo-miR-30c
    10. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-30b
    11. Lagothrix lagotricha lla-miR-30c
    12. Macaca mulatta mml-miR-30c-5p
    13. Macaca nemestrina (pig-tailed macaque) mne-miR-30c
    14. Microcebus murinus mmr-miR-30c
    15. Monodelphis domestica mdo-miR-30c-5p
    16. Mus musculus (house mouse) mmu-miR-30c-5p
    17. Ornithorhynchus anatinus oan-miR-30c-5p
    18. Oryzias latipes (Japanese medaka) ola-miR-30c
    19. Otolemur garnettii oga-miR-30c
    20. Ovis aries miscellaneous RNA
    21. Pan troglodytes (chimpanzee) ptr-miR-30c
    22. Papio hamadryas (hamadryas baboon) pha-miR-30c
    23. Pongo pygmaeus ppy-miR-30c
    24. Rattus norvegicus rno-miR-30c-5p
    25. Salmo salar (Atlantic salmon) ssa-miR-30a-5p
    26. Sus scrofa ssc-miR-30c-5p
    27. Tupaia chinensis tch-miR-30c-5p
    28. Tursiops truncatus miR-30c-5p
    29. Xenopus tropicalis xtr-miR-30c