Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ornithorhynchus anatinus (platypus) oan-miR-30c-5p URS000019907A_9258

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCUACACUCUCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 30 other species

  1. Alligator mississippiensis (American alligator) ami-miR-30c-5p
  2. Anolis carolinensis aca-miR-30c-5p
  3. Bos taurus bta-miR-30c
  4. Callorhinchus milii (elephant shark) eshark_mir-30_4
  5. Capra hircus (goat) chi-miR-30c-5p
  6. Cricetulus griseus cgr-miR-30c-2
  7. Equus caballus eca-miR-30c
  8. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-8947
  9. Gorilla gorilla gorilla ggo-miR-30c (MIR30C)
  10. Gorilla gorilla (western gorilla) ggo-miR-30c
  11. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-30b
  12. Homo sapiens hsa-miR-30c-5p
  13. Lagothrix lagotricha (brown woolly monkey) lla-miR-30c
  14. Macaca mulatta (Rhesus monkey) mml-miR-30c-5p
  15. Macaca nemestrina mne-miR-30c
  16. Microcebus murinus (gray mouse lemur) mmr-miR-30c
  17. Monodelphis domestica (gray short-tailed opossum) mdo-miR-30c-5p
  18. Mus musculus mmu-miR-30c-5p
  19. Oryzias latipes (Japanese medaka) ola-miR-30c
  20. Otolemur garnettii oga-miR-30c
  21. Ovis aries miscellaneous RNA
  22. Pan troglodytes ptr-miR-30c
  23. Papio hamadryas pha-miR-30c
  24. Pongo pygmaeus ppy-miR-30c
  25. Rattus norvegicus rno-miR-30c-5p
  26. Salmo salar ssa-miR-30a-5p
  27. Sus scrofa (pig) ssc-miR-30c-5p
  28. Tupaia chinensis tch-miR-30c-5p
  29. Tursiops truncatus miR-30c-5p
  30. Xenopus tropicalis xtr-miR-30c
Publications