Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-30c-5p URS000019907A_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 7 databases (RefSeq, TarBase, PSICQUIC, ENA, miRBase, LncBase, PirBase). Described in 43 papers. Mus musculus (house mouse) mmu-miR-30c-5p sequence is a product of 30c, miR-30, mmu-miR-30c, 30, Mir30c-2, Mir30c-1, mmu-miR-30c-5p, miR-30c, miR-30c-5p genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610007D13Rik, 0610009F02Rik, 0610009M14Rik, 0610010I05Rik, 0610010I13Rik, 0610010I17Rik, 0610010O12Rik, 0610012C09Rik, 0610025L15Rik, 0610030A03Rik.

Interactions 5

According to PSICQUIC, Mus musculus (house mouse) mmu-miR-30c-5p interacts with:

Interaction id Participant Synonyms
URS000019907A_10090-0 E9Q414 E9Q414
URS000019907A_10090-1 O08601 O08601
URS000019907A_10090-2 Q8BHI7 Q8BHI7
URS000019907A_10090-3 Q91YX5 Q91YX5
URS000019907A_10090-4 Q9QYS9 Q9QYS9

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUAAACAUCCUACACUCUCAGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 62 other species

    1. Alligator mississippiensis ami-miR-30c-5p
    2. Anolis carolinensis aca-miR-30c-5p
    3. Bos taurus (cattle) bta-miR-30c
    4. Callorhinchus milii (elephant shark) eshark_mir-30_4
    5. Capra hircus chi-miR-30c-5p
    6. Cricetulus griseus cgr-miR-30c-2
    7. Equus caballus (horse) eca-miR-30c
    8. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-8947
    9. Gorilla gorilla (western gorilla) ggo-miR-30c
    10. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-30b
    11. Homo sapiens hsa-miR-30c-5p
    12. Lagothrix lagotricha lla-miR-30c
    13. Macaca mulatta mml-miR-30c-5p
    14. Macaca nemestrina (pig-tailed macaque) mne-miR-30c
    15. Microcebus murinus mmr-miR-30c
    16. Monodelphis domestica mdo-miR-30c-5p
    17. Ornithorhynchus anatinus oan-miR-30c-5p
    18. Oryzias latipes (Japanese medaka) ola-miR-30c
    19. Otolemur garnettii oga-miR-30c
    20. Ovis aries miscellaneous RNA
    21. Pan troglodytes (chimpanzee) ptr-miR-30c
    22. Papio hamadryas (hamadryas baboon) pha-miR-30c
    23. Pongo pygmaeus ppy-miR-30c
    24. Rattus norvegicus rno-miR-30c-5p
    25. Salmo salar (Atlantic salmon) ssa-miR-30a-5p
    26. Sus scrofa ssc-miR-30c-5p
    27. Tupaia chinensis tch-miR-30c-5p
    28. Tursiops truncatus miR-30c-5p
    29. Xenopus tropicalis xtr-miR-30c