Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Citrus sinensis (sweet orange) csi-miR395b-3p URS00001945E4_2711

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGAAGUGUUUGGGGGAACUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Amborella trichopoda atr-miR395
  2. Ananas comosus microRNA 395a
  3. Arabidopsis lyrata aly-miR395g-3p
  4. Arabidopsis thaliana ath-miR395e
  5. Brassica napus bna-miR395c
  6. Brassica rapa (field mustard) bra-miR395a-3p
  7. Camelina sativa cas-miR395a
  8. Corchorus olitorius aly-miR395b-
  9. Cucumis melo cme-miR395f
  10. Glycine max (soybean) gma-miR395c
  11. Helianthus annuus ath-miR395a
  12. Linum usitatissimum lus-miR395a
  13. Malus domestica (apple) mdm-miR395b
  14. Manihot esculenta (cassava) mes-miR395a
  15. Nicotiana tabacum nta-miR395b
  16. Populus tomentosa Pto-miR395c
  17. Populus trichocarpa (black cottonwood) ptc-miR395j
  18. Prunus persica ppe-miR395g
  19. Ricinus communis (castor bean) rco-miR395c
  20. Rosa chinensis ath-miR395a
  21. Solanum tuberosum (potato) stu-miR395j
  22. Theobroma cacao tcc-miR395b
  23. Vigna unguiculata (cowpea) vun-miR395
  24. Vitis vinifera (wine grape) vvi-miR395d
Publications