Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Camelina sativa (false flax) cas-miR395d-3p URS00001945E4_90675

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGAAGUGUUUGGGGGAACUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Amborella trichopoda atr-miR395
  2. Ananas comosus microRNA 395a
  3. Arabidopsis lyrata (lyrate rockcress) aly-miR395e-3p
  4. Arabidopsis thaliana (thale cress) ath-miR395a
  5. Brassica napus bna-miR395a
  6. Brassica rapa (field mustard) bra-miR395d-3p
  7. Citrus sinensis (sweet orange) csi-miR395b-3p
  8. Corchorus olitorius aly-miR395b-
  9. Cucumis melo (muskmelon) cme-miR395e
  10. Glycine max (soybean) gma-miR395b
  11. Helianthus annuus ath-miR395a
  12. Linum usitatissimum (flax) lus-miR395c
  13. Malus domestica (apple) mdm-miR395c
  14. Manihot esculenta mes-miR395a
  15. Nicotiana tabacum (common tobacco) nta-miR395b
  16. Populus tomentosa Pto-miR395c
  17. Populus trichocarpa ptc-miR395j
  18. Prunus persica ppe-miR395i
  19. Ricinus communis (castor bean) rco-miR395a
  20. Rosa chinensis ath-miR395a
  21. Solanum tuberosum (potato) stu-miR395g
  22. Theobroma cacao tcc-miR395a
  23. Vigna unguiculata vun-miR395
  24. Vitis vinifera vvi-miR395e