Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-140-3p URS000018A236_7955

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Danio rerio. Annotated by 4 databases (ENA, miRBase, RefSeq, MirGeneDB). Described in 22 papers. Danio rerio (zebrafish) dre-miR-140-3p sequence is a product of mir-140*, mir140, miR-140, mirn140, dre-miR-140, miR-140-3p, 140*, dre-miR-140-3p genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UACCACAGGGUAGAACCACGGAC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 131 other species

    1. Alligator mississippiensis Ami-Mir-140-P1-v2_3p (mature (guide))
    2. Anolis carolinensis (green anole) Aca-Mir-140-P1-v2_3p (mature (guide))
    3. Bos taurus Bta-Mir-140-P1-v2_3p (mature (guide))
    4. Callorhinchus milii Cmi-Mir-140-P1-v2_3p (mature (guide))
    5. Canis lupus familiaris Cfa-Mir-140-P1-v2_3p (mature (guide))
    6. Cavia porcellus (domestic guinea pig) Cpo-Mir-140-P1-v2_3p (mature (guide))
    7. Chrysemys picta bellii Cpi-Mir-140-P1-v2_3p (mature (guide))
    8. Columba livia Cli-Mir-140-P1-v2_3p (mature (guide))
    9. Dasypus novemcinctus Dno-Mir-140-P1-v2_3p (mature (guide))
    10. Echinops telfairi Ete-Mir-140-P1-v2_3p (mature (guide))
    11. Eptatretus burgeri (inshore hagfish) Ebu-Mir-140-P3-v2_3p (mature (guide))
    12. Gadus morhua Gmo-Mir-140-P1-v2_3p (mature (guide))
    13. Gallus gallus Gga-Mir-140-P1-v2_3p (mature (guide))
    14. Gekko japonicus Gja-Mir-140-P1-v2_3p (mature (guide))
    15. Homo sapiens Hsa-Mir-140-P1-v2_3p (mature (guide))
    16. Lepisosteus oculatus (spotted gar) Loc-Mir-140-P1-v2_3p (mature (guide))
    17. Macaca mulatta Mml-Mir-140-P1-v2_3p (mature (guide))
    18. Microcaecilia unicolor Mun-Mir-140-P1-v2_3p (mature (guide))
    19. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-140-P1-v2_3p (mature (guide))
    20. Monopterus albus (swamp eel) Mal-Mir-140-P1-v2_3p (mature (guide))
    21. Mus musculus Mmu-Mir-140-P1-v2_3p (mature (guide))
    22. Ophiophagus hannah oha-miR-140-3p
    23. Ornithorhynchus anatinus Oan-Mir-140-P1-v2_3p (mature (guide))
    24. Oryctolagus cuniculus (rabbit) Ocu-Mir-140-P1-v2_3p (mature (guide))
    25. Rattus norvegicus (Norway rat) Rno-Mir-140-P1-v2_3p (mature (guide))
    26. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-140-P1-v2_3p (mature (guide))
    27. Scyliorhinus torazame (cloudy catshark) Sto-Mir-140-P1-v2_3p (mature (guide))
    28. Sus scrofa ssc-miR-140-3p
    29. Taeniopygia guttata tgu-miR-140-3p
    30. Tetraodon nigroviridis Tni-Mir-140-P1-v2_3p (mature (guide))
    31. Tor tambroides (Thai mahseer) miR-140-3p
    32. Xenopus laevis xla-miR-140-3p
    33. Xenopus tropicalis Xtr-Mir-140-P1-v2_3p (mature (guide))
    Publications New