Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-140-3p URS000018A236_7955

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACCACAGGGUAGAACCACGGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Alligator mississippiensis Ami-Mir-140-P1-v2_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-140-P1-v2_3p (mature (guide))
  3. Bos taurus Bta-Mir-140-P1-v2_3p (mature (guide))
  4. Callorhinchus milii (elephant shark) Cmi-Mir-140-P1-v2_3p (mature (guide))
  5. Canis lupus familiaris Cfa-Mir-140-P1-v2_3p (mature (guide))
  6. Cavia porcellus (domestic guinea pig) Cpo-Mir-140-P1-v2_3p (mature (guide))
  7. Chrysemys picta bellii Cpi-Mir-140-P1-v2_3p (mature (guide))
  8. Columba livia (rock pigeon) Cli-Mir-140-P1-v2_3p (mature (guide))
  9. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-140-P1-v2_3p (mature (guide))
  10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-140-P1-v2_3p (mature (guide))
  11. Eptatretus burgeri Ebu-Mir-140-P3-v2_3p (mature (guide))
  12. Gadus morhua (Atlantic cod) Gmo-Mir-140-P1-v2_3p (mature (guide))
  13. Gallus gallus (chicken) Gga-Mir-140-P1-v2_3p (mature (guide))
  14. Gekko japonicus Gja-Mir-140-P1-v2_3p (mature (guide))
  15. Homo sapiens Hsa-Mir-140-P1-v2_3p (mature (guide))
  16. Lepisosteus oculatus (spotted gar) Loc-Mir-140-P1-v2_3p (mature (guide))
  17. Macaca mulatta Mml-Mir-140-P1-v2_3p (mature (guide))
  18. Microcaecilia unicolor Mun-Mir-140-P1-v2_3p (mature (guide))
  19. Monodelphis domestica Mdo-Mir-140-P1-v2_3p (mature (guide))
  20. Monopterus albus Mal-Mir-140-P1-v2_3p (mature (guide))
  21. Mus musculus Mmu-Mir-140-P1-v2_3p (mature (guide))
  22. Ophiophagus hannah oha-miR-140-3p
  23. Ornithorhynchus anatinus Oan-Mir-140-P1-v2_3p (mature (guide))
  24. Oryctolagus cuniculus Ocu-Mir-140-P1-v2_3p (mature (guide))
  25. Rattus norvegicus (Norway rat) Rno-Mir-140-P1-v2_3p (mature (guide))
  26. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-140-P1-v2_3p (mature (guide))
  27. Scyliorhinus torazame (cloudy catshark) Sto-Mir-140-P1-v2_3p (mature (guide))
  28. Sus scrofa ssc-miR-140-3p
  29. Taeniopygia guttata (zebra finch) tgu-miR-140-3p
  30. Tetraodon nigroviridis Tni-Mir-140-P1-v2_3p (mature (guide))
  31. Tor tambroides (Thai mahseer) miR-140-3p
  32. Xenopus laevis xla-miR-140-3p
  33. Xenopus tropicalis Xtr-Mir-140-P1-v2_3p (mature (guide))
Publications