Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-140-P1-v2_3p (mature (guide)) URS000018A236_13616

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACCACAGGGUAGAACCACGGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-140-P1-v2_3p (mature (guide))
  2. Anolis carolinensis Aca-Mir-140-P1-v2_3p (mature (guide))
  3. Bos taurus (cattle) Bta-Mir-140-P1-v2_3p (mature (guide))
  4. Callorhinchus milii (elephant shark) Cmi-Mir-140-P1-v2_3p (mature (guide))
  5. Canis lupus familiaris Cfa-Mir-140-P1-v2_3p (mature (guide))
  6. Cavia porcellus Cpo-Mir-140-P1-v2_3p (mature (guide))
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-140-P1-v2_3p (mature (guide))
  8. Columba livia Cli-Mir-140-P1-v2_3p (mature (guide))
  9. Danio rerio (zebrafish) dre-miR-140-3p
  10. Dasypus novemcinctus Dno-Mir-140-P1-v2_3p (mature (guide))
  11. Echinops telfairi Ete-Mir-140-P1-v2_3p (mature (guide))
  12. Eptatretus burgeri (inshore hagfish) Ebu-Mir-140-P3-v2_3p (mature (guide))
  13. Gadus morhua Gmo-Mir-140-P1-v2_3p (mature (guide))
  14. Gallus gallus Gga-Mir-140-P1-v2_3p (mature (guide))
  15. Gekko japonicus Gja-Mir-140-P1-v2_3p (mature (guide))
  16. Homo sapiens (human) Hsa-Mir-140-P1-v2_3p (mature (guide))
  17. Lepisosteus oculatus (spotted gar) Loc-Mir-140-P1-v2_3p (mature (guide))
  18. Macaca mulatta (Rhesus monkey) Mml-Mir-140-P1-v2_3p (mature (guide))
  19. Microcaecilia unicolor Mun-Mir-140-P1-v2_3p (mature (guide))
  20. Monopterus albus Mal-Mir-140-P1-v2_3p (mature (guide))
  21. Mus musculus (house mouse) Mmu-Mir-140-P1-v2_3p (mature (guide))
  22. Ophiophagus hannah oha-miR-140-3p
  23. Ornithorhynchus anatinus (platypus) Oan-Mir-140-P1-v2_3p (mature (guide))
  24. Oryctolagus cuniculus (rabbit) Ocu-Mir-140-P1-v2_3p (mature (guide))
  25. Rattus norvegicus (Norway rat) Rno-Mir-140-P1-v2_3p (mature (guide))
  26. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-140-P1-v2_3p (mature (guide))
  27. Scyliorhinus torazame Sto-Mir-140-P1-v2_3p (mature (guide))
  28. Sus scrofa (pig) ssc-miR-140-3p
  29. Taeniopygia guttata (zebra finch) tgu-miR-140-3p
  30. Tetraodon nigroviridis Tni-Mir-140-P1-v2_3p (mature (guide))
  31. Tor tambroides miR-140-3p
  32. Xenopus laevis xla-miR-140-3p
  33. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-140-P1-v2_3p (mature (guide))