Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cricetulus griseus (Chinese hamster) cgr-miR-23b-3p URS0000183BED_10029

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Cricetulus griseus. Annotated by 2 databases (miRBase, RefSeq). Cricetulus griseus (Chinese hamster) cgr-miR-23b-3p sequence is a product of cgr-miR-23b, miR-23, Mir23b, miR-23b, cgr-miR-23b-3p, miR-23b-3p genes. Found in the Cricetulus griseus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AUCACAUUGCCAGGGAUUACC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 29 other species

    1. Anolis carolinensis aca-miR-23b-3p
    2. Callithrix jacchus cja-miR-23b
    3. Callorhinchus milii (elephant shark) eshark_mir-23_1
    4. Capra hircus (goat) chi-miR-23b-3p
    5. Chiloscyllium plagiosum microRNA cpl-miR-23b
    6. Chrysemys picta cpi-miR-23b-3p
    7. Cyprinus carpio ccr-miR-23b
    8. Daubentonia madagascariensis dma-miR-23b
    9. Equus caballus eca-miR-23b
    10. Gallus gallus gga-miR-23b-3p
    11. Haplochromis burtoni abu-miR-23b
    12. Homo sapiens hsa-miR-23b-3p
    13. Ictalurus punctatus (channel catfish) ipu-miR-23b
    14. Macaca mulatta mml-miR-23b-3p
    15. Maylandia zebra (zebra mbuna) mze-miR-23b
    16. Microcebus murinus (gray mouse lemur) mmr-miR-23b
    17. Monodelphis domestica mdo-miR-23b-3p
    18. Mus musculus (house mouse) mmu-miR-23b-3p
    19. Neolamprologus brichardi nbr-miR-23b
    20. Nomascus leucogenys nle-miR-23b
    21. Oreochromis niloticus (Nile tilapia) oni-miR-23b
    22. Ovis aries miscellaneous RNA
    23. Papio hamadryas pha-miR-23b
    24. Pundamilia nyererei pny-miR-23b
    25. Rattus norvegicus rno-miR-23b-3p
    26. Taeniopygia guttata tgu-miR-23-3p
    27. Tursiops truncatus (common bottlenose dolphin) miR-23b
    28. Xenopus laevis xla-miR-23b-3p
    29. Xenopus tropicalis (tropical clawed frog) xtr-miR-23b
    Publications