Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Glycine max (soybean) gma-miR159a-3p URS00001834B5_3847

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGGAUUGAAGGGAGCUCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 31 other species

  1. Allium sativum (garlic) partial miR159a_1
  2. Amborella trichopoda atr-miR159
  3. Ananas comosus (pineapple) miR159d
  4. Arabidopsis lyrata aly-miR159a-3p
  5. Arabidopsis thaliana (thale cress) ath-miR159a
  6. Arachis hypogaea (peanut) ahy-miR159
  7. Asparagus officinalis (garden asparagus) aof-miR159
  8. Brassica napus bna-miR159
  9. Brassica rapa (field mustard) bra-miR159a
  10. Carica papaya (papaya) cpa-miR159a
  11. Citrus sinensis (sweet orange) csi-miR159a-3p
  12. Corchorus capsularis (jute) sRNA CCACVL1_25668
  13. Corchorus olitorius ahy-miR1
  14. Cucumis melo cme-miR159a
  15. Cynara cardunculus var. scolymus cca-miR159a
  16. Fragaria vesca subsp. vesca fve-miR159a-3p
  17. Helianthus annuus (common sunflower) ath-miR159a
  18. Helianthus tuberosus htu-miR159a
  19. Hevea brasiliensis hbr-miR159a
  20. Malus domestica (apple) mdm-miR159d
  21. Manihot esculenta mes-miR159b
  22. Medicago truncatula (barrel medic) mtr-miR159a
  23. Nicotiana tabacum nta-miR159
  24. Phaseolus vulgaris pvu-miR159a.1
  25. Populus tomentosa Pto-miR159b
  26. Populus trichocarpa ptc-miR159b
  27. Prunus persica ppe-miR159
  28. Ricinus communis (castor bean) rco-miR159
  29. Solanum lycopersicum sly-miR159
  30. Vitis vinifera (wine grape) vvi-miR159c
  31. Vriesea carinata vca-miR159-3p
Publications