Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Brassica napus (rape) bna-miR159 URS00001834B5_3708

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGGAUUGAAGGGAGCUCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 31 other species

  1. Allium sativum partial miR159a_1
  2. Amborella trichopoda atr-miR159
  3. Ananas comosus miR159d
  4. Arabidopsis lyrata (lyrate rockcress) aly-miR159a-3p
  5. Arabidopsis thaliana ath-miR159a
  6. Arachis hypogaea ahy-miR159
  7. Asparagus officinalis (garden asparagus) aof-miR159
  8. Brassica rapa bra-miR159a
  9. Carica papaya (papaya) cpa-miR159a
  10. Citrus sinensis (sweet orange) csi-miR159a-3p
  11. Corchorus capsularis sRNA CCACVL1_25668
  12. Corchorus olitorius ahy-miR1
  13. Cucumis melo (muskmelon) cme-miR159a
  14. Cynara cardunculus var. scolymus cca-miR159a
  15. Fragaria vesca subsp. vesca fve-miR159a-3p
  16. Glycine max (soybean) gma-miR159a-3p
  17. Helianthus annuus ath-miR159a
  18. Helianthus tuberosus (Jerusalem artichoke) htu-miR159a
  19. Hevea brasiliensis hbr-miR159a
  20. Malus domestica mdm-miR159e
  21. Manihot esculenta mes-miR159a-3p
  22. Medicago truncatula (barrel medic) mtr-miR159a
  23. Nicotiana tabacum nta-miR159
  24. Phaseolus vulgaris (string bean) pvu-miR159a.1
  25. Populus tomentosa Pto-miR159b
  26. Populus trichocarpa (black cottonwood) ptc-miR159b
  27. Prunus persica (peach) ppe-miR159
  28. Ricinus communis rco-miR159
  29. Solanum lycopersicum sly-miR159
  30. Vitis vinifera (wine grape) vvi-miR159c
  31. Vriesea carinata vca-miR159-3p
Publications