Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-16 precursor (hsa-mir-16-2) URS000017EE98_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR16-2: To investigate the molecular mechanism of how R-2HG/ERĪ± decreases miR16-5p expression at the transcriptional level, Zhang et al. (2021) applied the Ensembl website with JASPAR database approaches to search for potential estrogen response elements (EREs) on the 3-kb region of miR16-1 and MIR16-2 promoters [PMC8479483]. Among the top 10 miRNAs with the highest absolute amount, MIR16-2 was identified [PMC8010072]. MIR16-2 is located on the intronic region of Structural Maintenance of Chromosomes 4 (SMC4) on chromosome 3 [PMC9553902]. Furthermore, CHORDC1 and MIR16-2 were found to be upregulated at D15 with fold changes of 4.54 [PMC8407676]. The expression levels of MIR16-2 were observed to be high during the S phase and gradually decrease during G2M and G1 phases in fibroblasts [PMC8713755]. In lung cancer, overexpression of BCL2 was associated with underexpression of MIR15A, MIR16-1, and MIR16-2 [PMC2683874]. Similarly, in kidney tumors, overexpression of DFFB, HTATIP, and RELA was related to underexpression of MIR124A-1, MIR124A-2, and MIR124A-3 [PMC2683874].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUCCACUCUAGCAGCACGUAAAUAUUGGCGUAGUGAAAUAUAUAUUAAACACCAAUAUUACUGUGCUGCUUUAGUGUGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Publications