Aotus nancymaae (Ma's night monkey) microRNA 16-2 (ENSANAG00000002484.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Aotus nancymaae (Ma's night monkey) microRNA 16-2 (ENSANAG00000002484.1) URS000017EE98_37293

81 nucleotides
1 database (Ensembl)
Found in 7 other species
16 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GUUCCACUCUAGCAGCACGUAAAUAUUGGCGUAGUGAAAUAUAUAUUAAACACCAAUAUUACUGUGCUGCUUUAGUGUGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Callithrix jacchus (white-tufted-ear marmoset) mir-16 microRNA precursor family
Cebus imitator microRNA 16-2 (ENSCCAG00000004129.1)
Gorilla gorilla gorilla microRNA 16-2 (ENSGGOG00000034256.2)
Homo sapiens microRNA hsa-mir-16 precursor (hsa-mir-16-2)
Pan paniscus microRNA 16-2 (ENSPPAG00000012965.1)
Pongo abelii (Sumatran orangutan) miRNA
Saimiri boliviensis boliviensis microRNA 16-2 (ENSSBOG00000018735.1)

Publications