Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila ficusphila tRNA secondary structure diagram

Drosophila ficusphila tRNA URS000017A2F3_30025

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUCCAUGGUGUAAUGGUUAGCACUCAGGACUCUGAAUCCUGCGAUCCGAGUUCAAAUCUCGGUGGAACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 43 other species

  1. Anopheles arabiensis tRNA tRNA-Gln
  2. Anopheles coluzzii tRNA-Gln for anticodon CUG
  3. Anopheles gambiae tRNA tRNA-Gln
  4. Anopheles gambiae str. PEST tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  5. Anopheles maculatus tRNA tRNA-Gln
  6. Anopheles melas tRNA tRNA-Gln
  7. Anopheles merus (Mosquito) tRNA tRNA-Gln
  8. Anopheles quadriannulatus (Mosquito) tRNA tRNA-Gln
  9. Anopheles stephensi tRNA tRNA-Gln
  10. Bactrocera dorsalis tRNA-Gln
  11. Bactrocera latifrons (Solanum fruit fly) tRNA-Gln
  12. Bactrocera tryoni tRNA-Gln
  13. Branchiostoma floridae tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1)
  14. Ceratitis capitata (Mediterranean fruit fly) tRNA-Gln
  15. Culex quinquefasciatus tRNA-Gln
  16. Drosophila ananassae tRNA-Gln (CTG) (tRNA-Gln-CTG-3 1 to 6)
  17. Drosophila busckii tRNA
  18. Drosophila erecta tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 5)
  19. Drosophila grimshawi tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 10)
  20. Drosophila guanche tRNA.Gln
  21. Drosophila gunungcola tRNA-OTHER
  22. Drosophila melanogaster (fruit fly) transfer RNA:Glutamine-CTG 2-5 (Dmel_CR31669, Dmel_CR31939, Dmel_CR31943, Dmel_CR31944, Dmel_CR32785)
  23. Drosophila mojavensis tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 5)
  24. Drosophila persimilis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  25. Drosophila pseudoobscura pseudoobscura tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  26. Drosophila sechellia tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 5)
  27. Drosophila simulans tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 5)
  28. Drosophila virilis tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  29. Drosophila willistoni tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  30. Drosophila yakuba tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  31. Gadus morhua tRNA-Gln (CTG) (tRNA-Gln-CTG-3 1 to 4)
  32. Lineus longissimus (Bootlace worm) misc RNA ENSLLNG00015025687.1
  33. Lucilia cuprina tRNA-Gln for anticodon CUG
  34. Mercenaria mercenaria (Hard clam (quahog)) tRNA-Gln
  35. Musca domestica tRNA MDOA010175
  36. Mya arenaria (Soft-shell clam) transfer RNA glutamine (anticodon CUG)
  37. Panonychus citri (Citrus red mite) transfer RNA glutamine (anticodon CUG)
  38. Petromyzon marinus tRNA-Gln (CTG) (tRNA-Gln-CTG-4 1 to 3)
  39. Priapulus caudatus (Penis worm) tRNA-Gln
  40. Rhagoletis pomonella (Apple magot fly) tRNA-Gln
  41. Stomoxys calcitrans tRNA-Gln
  42. Tetranychus urticae tRNA tetur02g15108
  43. Thrips palmi (Melon Thrips) tRNA-Gln
2D structure Publications