Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cricetulus griseus (Chinese hamster) cgr-miR-100-5p URS000017A252_10029

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACCCGUAGAUCCGAACUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Capra hircus chi-miR-100-5p
  2. Cervus elaphus (red deer) cel-miR-100
  3. Chrysemys picta cpi-miR-100-5p
  4. Cyprinus carpio ccr-miR-100
  5. Daubentonia madagascariensis (aye-aye) dma-miR-100
  6. Monodelphis domestica (gray short-tailed opossum) mdo-miR-100-5p
  7. Mus musculus Mus_musculus piRNA piR-mmu-8085145
  8. Patiria miniata (sea bat) pmi-miR-100-5p
  9. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-100
  10. Sarcophilus harrisii sha-miR-100
  11. Taeniopygia guttata (zebra finch) tgu-miR-100-5p
  12. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-1808276
Publications