v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus pahari tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1) secondary structure diagram

Mus pahari tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1) URS0000176051_10093

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCCGGAUGAUCCUCAGUGGUCUGGGGUGCAGGCUUCAAACCUGUAGCUGUUUAGCGACAGAGUGGUUCAAUUCCACCUUUCGGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Anolis carolinensis tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2. Dipodomys ordii tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  3. Mus caroli tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  4. Mus musculus castaneus tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  5. Mus musculus domesticus tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  6. Mus musculus musculus tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  7. Mus musculus tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  8. Mus spretus tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  9. Podarcis lilfordi tRNA.SeC
  10. Rattus norvegicus tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
 2D structure Publications