Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-miR-221-3p URS0000170CF4_9986

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUACAUUGUCUGCUGGGUUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 51 other species

  1. Alligator mississippiensis ami-miR-221-3p
  2. Anolis carolinensis Aca-Mir-221-P2a_3p (mature (guide))
  3. Bos taurus Bta-Mir-221-P2a_3p (mature (guide))
  4. Canis lupus familiaris Cfa-Mir-221-P2a_3p (mature (guide))
  5. Capra hircus miR-221
  6. Cavia porcellus cpo-miR-221-3p
  7. Cervus elaphus cel-miR-221
  8. Columba livia (rock pigeon) Cli-Mir-221-P2a_3p (mature (guide))
  9. Cricetulus griseus cgr-miR-221-3p
  10. Danio rerio (zebrafish) dre-miR-221-3p
  11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-221-3p
  12. Daubentonia madagascariensis dma-miR-221
  13. Echinops telfairi Ete-Mir-221-P2a_3p (mature (guide))
  14. Equus caballus eca-miR-221
  15. Gadus morhua (Atlantic cod) Gmo-Mir-221-P2a1_3p (mature (guide))
  16. Gallus gallus (chicken) gga-miR-221-3p
  17. Gekko japonicus Gja-Mir-221-P2a_3p (mature (guide))
  18. Gorilla gorilla gorilla ggo-miR-221 (MIR221)
  19. Gorilla gorilla ggo-miR-221
  20. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-221
  21. Homo sapiens hsa-miR-221-3p
  22. Latimeria chalumnae Lch-Mir-221-P2a_3p (mature (guide))
  23. Lepisosteus oculatus Loc-Mir-221-P2a_3p (mature (guide))
  24. Macaca mulatta mml-miR-221-3p
  25. Maylandia zebra (zebra mbuna) mze-miR-221
  26. Microcebus murinus mmr-miR-221
  27. Monodelphis domestica (gray short-tailed opossum) mdo-miR-221-3p
  28. Monopterus albus Mal-Mir-221-P2a1_3p (mature (guide))
  29. Mus musculus (house mouse) mmu-miR-221-3p
  30. Neolamprologus brichardi nbr-miR-221
  31. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-221
  32. Ophiophagus hannah oha-miR-221-3p
  33. Oreochromis niloticus oni-miR-221
  34. Oryzias latipes (Japanese medaka) ola-miR-221
  35. Otolemur garnettii oga-miR-221
  36. Ovis aries miscellaneous RNA
  37. Pan paniscus (pygmy chimpanzee) ppa-miR-221
  38. Pan troglodytes ptr-miR-221
  39. Papio hamadryas pha-miR-221
  40. Pongo pygmaeus (Bornean orangutan) ppy-miR-221
  41. Pundamilia nyererei pny-miR-221
  42. Rattus norvegicus (Norway rat) rno-miR-221-3p
  43. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-221
  44. Sarcophilus harrisii Sha-Mir-221-P2a_3p (mature (guide))
  45. Sphenodon punctatus (tuatara) Spt-Mir-221-P2a_3p (mature (guide))
  46. Taeniopygia guttata (zebra finch) tgu-miR-221-3p
  47. Takifugu rubripes fru-miR-221
  48. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-221
  49. Tor tambroides miR-221-3p
  50. Xenopus laevis Xla-Mir-221-P2a4_3p (mature (guide))
  51. Xenopus tropicalis (tropical clawed frog) xtr-miR-221
Publications