Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) Bta-Mir-221-P1_3p (mature (guide)) URS0000170CF4_9913

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Bos taurus. Annotated by 1 database (MirGeneDB). Described in 1 paper. Found in the cattle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGCUACAUUGUCUGCUGGGUUUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 77 other species

    1. Alligator mississippiensis ami-miR-221-3p
    2. Anolis carolinensis Aca-Mir-221-P1_3p (mature (guide))
    3. Canis lupus familiaris Cfa-Mir-221-P1_3p (mature (guide))
    4. Capra hircus miR-221
    5. Cavia porcellus (domestic guinea pig) cpo-miR-221-3p
    6. Cervus elaphus (red deer) cel-miR-221
    7. Chrysemys picta bellii Cpi-Mir-221-P1_3p* (star (passenger))
    8. Columba livia (rock pigeon) Cli-Mir-221-P1_3p (mature (guide))
    9. Cricetulus griseus cgr-miR-221-3p
    10. Danio rerio (zebrafish) dre-miR-221-3p
    11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-221-3p
    12. Daubentonia madagascariensis (aye-aye) dma-miR-221
    13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-221-P1_3p (mature (guide))
    14. Equus caballus (horse) eca-miR-221
    15. Gallus gallus (chicken) gga-miR-221-3p
    16. Gorilla gorilla (western gorilla) ggo-miR-221
    17. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-221
    18. Homo sapiens hsa-miR-221-3p
    19. Macaca mulatta mml-miR-221-3p
    20. Maylandia zebra mze-miR-221
    21. Microcebus murinus mmr-miR-221
    22. Monodelphis domestica mdo-miR-221-3p
    23. Mus musculus (house mouse) mmu-miR-221-3p
    24. Neolamprologus brichardi nbr-miR-221
    25. Nomascus leucogenys nle-miR-221
    26. Ophiophagus hannah oha-miR-221-3p
    27. Oreochromis niloticus oni-miR-221
    28. Ornithorhynchus anatinus Oan-Mir-221-P1_3p* (star (passenger))
    29. Oryctolagus cuniculus (rabbit) ocu-miR-221-3p
    30. Oryzias latipes (Japanese medaka) ola-miR-221
    31. Otolemur garnettii oga-miR-221
    32. Ovis aries miscellaneous RNA
    33. Pan paniscus ppa-miR-221
    34. Pan troglodytes (chimpanzee) ptr-miR-221
    35. Papio hamadryas (hamadryas baboon) pha-miR-221
    36. Pongo pygmaeus ppy-miR-221
    37. Pundamilia nyererei pny-miR-221
    38. Rattus norvegicus rno-miR-221-3p
    39. Saimiri boliviensis boliviensis sbo-miR-221
    40. Sarcophilus harrisii Sha-Mir-221-P1_3p (mature (guide))
    41. Scyliorhinus torazame (cloudy catshark) Sto-Mir-221-P1_3p* (star (passenger))
    42. Taeniopygia guttata (zebra finch) tgu-miR-221-3p
    43. Takifugu rubripes (torafugu) fru-miR-221
    44. Tetraodon nigroviridis tni-miR-221
    45. Tor tambroides miR-221-3p
    46. Xenopus tropicalis xtr-miR-221