Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) ptr-miR-221 URS0000170CF4_9598

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Pan troglodytes. Annotated by 2 databases (RefSeq, miRBase). Described in 3 papers. Pan troglodytes (chimpanzee) ptr-miR-221 sequence is a product of MIR221, ptr-miR-221, miR-221 genes. Found in the chimpanzee reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGCUACAUUGUCUGCUGGGUUUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 77 other species

    1. Alligator mississippiensis ami-miR-221-3p
    2. Anolis carolinensis Aca-Mir-221-P1_3p (mature (guide))
    3. Bos taurus (cattle) Bta-Mir-221-P1_3p (mature (guide))
    4. Canis lupus familiaris Cfa-Mir-221-P1_3p (mature (guide))
    5. Capra hircus miR-221
    6. Cavia porcellus (domestic guinea pig) cpo-miR-221-3p
    7. Cervus elaphus (red deer) cel-miR-221
    8. Chrysemys picta bellii Cpi-Mir-221-P1_3p* (star (passenger))
    9. Columba livia (rock pigeon) Cli-Mir-221-P1_3p (mature (guide))
    10. Cricetulus griseus cgr-miR-221-3p
    11. Danio rerio (zebrafish) dre-miR-221-3p
    12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-221-3p
    13. Daubentonia madagascariensis (aye-aye) dma-miR-221
    14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-221-P1_3p (mature (guide))
    15. Equus caballus (horse) eca-miR-221
    16. Gallus gallus (chicken) gga-miR-221-3p
    17. Gorilla gorilla (western gorilla) ggo-miR-221
    18. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-221
    19. Homo sapiens hsa-miR-221-3p
    20. Macaca mulatta mml-miR-221-3p
    21. Maylandia zebra mze-miR-221
    22. Microcebus murinus mmr-miR-221
    23. Monodelphis domestica mdo-miR-221-3p
    24. Mus musculus (house mouse) mmu-miR-221-3p
    25. Neolamprologus brichardi nbr-miR-221
    26. Nomascus leucogenys nle-miR-221
    27. Ophiophagus hannah oha-miR-221-3p
    28. Oreochromis niloticus oni-miR-221
    29. Ornithorhynchus anatinus Oan-Mir-221-P1_3p* (star (passenger))
    30. Oryctolagus cuniculus (rabbit) ocu-miR-221-3p
    31. Oryzias latipes (Japanese medaka) ola-miR-221
    32. Otolemur garnettii oga-miR-221
    33. Ovis aries miscellaneous RNA
    34. Pan paniscus ppa-miR-221
    35. Papio hamadryas (hamadryas baboon) pha-miR-221
    36. Pongo pygmaeus ppy-miR-221
    37. Pundamilia nyererei pny-miR-221
    38. Rattus norvegicus rno-miR-221-3p
    39. Saimiri boliviensis boliviensis sbo-miR-221
    40. Sarcophilus harrisii Sha-Mir-221-P1_3p (mature (guide))
    41. Scyliorhinus torazame (cloudy catshark) Sto-Mir-221-P1_3p* (star (passenger))
    42. Taeniopygia guttata (zebra finch) tgu-miR-221-3p
    43. Takifugu rubripes (torafugu) fru-miR-221
    44. Tetraodon nigroviridis tni-miR-221
    45. Tor tambroides miR-221-3p
    46. Xenopus tropicalis xtr-miR-221