Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-221-3p URS0000170CF4_7955

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Danio rerio. Annotated by 4 databases (RefSeq, miRBase, MirGeneDB, ENA). Described in 16 papers. Danio rerio (zebrafish) dre-miR-221-3p sequence is a product of miR-221, dre-miR-221, mir221, dre-miR-221-3p, miR-221-3p genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGCUACAUUGUCUGCUGGGUUUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 45 other species

    1. Alligator mississippiensis ami-miR-221-3p
    2. Anolis carolinensis Aca-Mir-221-P1_3p (mature (guide))
    3. Bos taurus (cattle) Bta-Mir-221-P1_3p (mature (guide))
    4. Canis lupus familiaris (dog) Cfa-Mir-221-P1_3p (mature (guide))
    5. Capra hircus miR-221
    6. Cavia porcellus (domestic guinea pig) cpo-miR-221-3p
    7. Cervus elaphus cel-miR-221
    8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-221-P1_3p* (star (passenger))
    9. Columba livia Cli-Mir-221-P1_3p (mature (guide))
    10. Cricetulus griseus cgr-miR-221-3p
    11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-221-3p
    12. Daubentonia madagascariensis dma-miR-221
    13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-221-P1_3p (mature (guide))
    14. Equus caballus eca-miR-221
    15. Gallus gallus gga-miR-221-3p
    16. Gorilla gorilla (western gorilla) ggo-miR-221
    17. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-221
    18. Homo sapiens (human) hsa-miR-221-3p
    19. Macaca mulatta mml-miR-221-3p
    20. Maylandia zebra (zebra mbuna) mze-miR-221
    21. Microcebus murinus mmr-miR-221
    22. Monodelphis domestica mdo-miR-221-3p
    23. Mus musculus mmu-miR-221-3p
    24. Neolamprologus brichardi nbr-miR-221
    25. Nomascus leucogenys nle-miR-221
    26. Ophiophagus hannah (king cobra) oha-miR-221-3p
    27. Oreochromis niloticus (Nile tilapia) oni-miR-221
    28. Ornithorhynchus anatinus (platypus) Oan-Mir-221-P1_3p* (star (passenger))
    29. Oryctolagus cuniculus ocu-miR-221-3p
    30. Oryzias latipes ola-miR-221
    31. Otolemur garnettii oga-miR-221
    32. Ovis aries miscellaneous RNA
    33. Pan paniscus (pygmy chimpanzee) ppa-miR-221
    34. Pan troglodytes ptr-miR-221
    35. Papio hamadryas (hamadryas baboon) pha-miR-221
    36. Pongo pygmaeus (Bornean orangutan) ppy-miR-221
    37. Pundamilia nyererei pny-miR-221
    38. Rattus norvegicus rno-miR-221-3p
    39. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-221
    40. Sarcophilus harrisii Sha-Mir-221-P1_3p (mature (guide))
    41. Scyliorhinus torazame (cloudy catshark) Sto-Mir-221-P1_3p* (star (passenger))
    42. Taeniopygia guttata tgu-miR-221-3p
    43. Takifugu rubripes fru-miR-221
    44. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-221
    45. Tor tambroides miR-221-3p
    46. Xenopus tropicalis xtr-miR-221