v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-221-3p URS0000170CF4_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-221: Rno-mir-221 is a microRNA that has been studied in various contexts. In a study by Roth et al, it was found that rno-mir-221, along with rno-miR-222, rno-miR-25, and rno-miR-26b, showed differential expression between rats with polycystic ovary syndrome (PCOS) and control rats [PMC4838149]. Additionally, in DHT-treated ovaries, rno-mir-221 was found to be highly abundant along with other miRNAs such as rno-miR-222 and rno-miR-26b [PMC3682887]. Furthermore, microRNA profiling has identified rno-mir-221 as being associated with cardiac hypertrophy [PMC5856749]. In terms of target genes, it has been reported that twelve miRNAs including rno-mir-221 have experimentally validated targets [PMC3682887]. Overall, these studies highlight the importance of rno-mir-221 in various biological processes and its potential role as a biomarker or therapeutic target.

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCUACAUUGUCUGCUGGGUUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 51 other species

  1. Alligator mississippiensis ami-miR-221-3p
  2. Anolis carolinensis Aca-Mir-221-P2a_3p (mature (guide))
  3. Bos taurus (cattle) Bta-Mir-221-P2a_3p (mature (guide))
  4. Canis lupus familiaris Cfa-Mir-221-P2a_3p (mature (guide))
  5. Capra hircus (goat) miR-221
  6. Cavia porcellus cpo-miR-221-3p
  7. Cervus elaphus (red deer) cel-miR-221
  8. Columba livia Cli-Mir-221-P2a_3p (mature (guide))
  9. Cricetulus griseus (Chinese hamster) cgr-miR-221-3p
  10. Danio rerio dre-miR-221-3p
  11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-221-3p
  12. Daubentonia madagascariensis dma-miR-221
  13. Echinops telfairi Ete-Mir-221-P2a_3p (mature (guide))
  14. Equus caballus (horse) eca-miR-221
  15. Gadus morhua (Atlantic cod) Gmo-Mir-221-P2a1_3p (mature (guide))
  16. Gallus gallus (chicken) gga-miR-221-3p
  17. Gekko japonicus Gja-Mir-221-P2a_3p (mature (guide))
  18. Gorilla gorilla gorilla ggo-miR-221 (MIR221)
  19. Gorilla gorilla ggo-miR-221
  20. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-221
  21. Homo sapiens (human) hsa-miR-221-3p
  22. Latimeria chalumnae Lch-Mir-221-P2a_3p (mature (guide))
  23. Lepisosteus oculatus Loc-Mir-221-P2a_3p (mature (guide))
  24. Macaca mulatta (Rhesus monkey) mml-miR-221-3p
  25. Maylandia zebra (zebra mbuna) mze-miR-221
  26. Microcebus murinus mmr-miR-221
  27. Monodelphis domestica (gray short-tailed opossum) mdo-miR-221-3p
  28. Monopterus albus Mal-Mir-221-P2a1_3p (mature (guide))
  29. Mus musculus (house mouse) mmu-miR-221-3p
  30. Neolamprologus brichardi (lyretail cichlid) nbr-miR-221
  31. Nomascus leucogenys nle-miR-221
  32. Ophiophagus hannah (king cobra) oha-miR-221-3p
  33. Oreochromis niloticus oni-miR-221
  34. Oryctolagus cuniculus ocu-miR-221-3p
  35. Oryzias latipes ola-miR-221
  36. Otolemur garnettii (small-eared galago) oga-miR-221
  37. Ovis aries miscellaneous RNA
  38. Pan paniscus ppa-miR-221
  39. Pan troglodytes ptr-miR-221
  40. Papio hamadryas (hamadryas baboon) pha-miR-221
  41. Pongo pygmaeus ppy-miR-221
  42. Pundamilia nyererei pny-miR-221
  43. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-221
  44. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-221-P2a_3p (mature (guide))
  45. Sphenodon punctatus (tuatara) Spt-Mir-221-P2a_3p (mature (guide))
  46. Taeniopygia guttata tgu-miR-221-3p
  47. Takifugu rubripes (torafugu) fru-miR-221
  48. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-221
  49. Tor tambroides (Thai mahseer) miR-221-3p
  50. Xenopus laevis Xla-Mir-221-P2a4_3p (mature (guide))
  51. Xenopus tropicalis (tropical clawed frog) xtr-miR-221
 Publications