Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) ptr-miR-487a URS000016FD1B_9598

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUCAUACAGGGACAUCCAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Bos taurus Bta-Mir-154-P16_3p (mature (guide))
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-487a
  3. Canis lupus familiaris Cfa-Mir-154-P16_3p (mature (guide))
  4. Capra hircus chi-miR-487a-3p
  5. Cavia porcellus cpo-miR-487a-3p
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-487a-3p
  7. Echinops telfairi Ete-Mir-154-P16_3p (mature (guide))
  8. Equus caballus eca-miR-487a
  9. Homo sapiens hsa-miR-487a-3p
  10. Macaca mulatta mml-miR-487a
  11. Oryctolagus cuniculus ocu-miR-487a-3p
  12. Pongo pygmaeus (Bornean orangutan) ppy-miR-487a
  13. Pteropus alecto pal-miR-487a-3p
Publications