Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-miR-487a-3p URS000016FD1B_9361

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUCAUACAGGGACAUCCAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Bos taurus (cattle) Bta-Mir-154-P16_3p (mature (guide))
  2. Callithrix jacchus cja-miR-487a
  3. Canis lupus familiaris Cfa-Mir-154-P16_3p (mature (guide))
  4. Capra hircus (goat) chi-miR-487a-3p
  5. Cavia porcellus cpo-miR-487a-3p
  6. Echinops telfairi Ete-Mir-154-P16_3p (mature (guide))
  7. Equus caballus (horse) eca-miR-487a
  8. Homo sapiens (human) hsa-miR-487a-3p
  9. Macaca mulatta (Rhesus monkey) mml-miR-487a
  10. Oryctolagus cuniculus ocu-miR-487a-3p
  11. Pan troglodytes ptr-miR-487a
  12. Pongo pygmaeus ppy-miR-487a
  13. Pteropus alecto (black flying fox) pal-miR-487a-3p