Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) CFAP61 antisense RNA 1 URS000016EC15_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CFAP61-AS1: CFAP61-AS1 is a long non-coding RNA (lncRNA) that has been identified as one of the lncRNAs included in the overall survival (OS) signature and progression-free survival (PFS) signature in gastric cancer patients [PMC8855154]. In the OS signature, CFAP61-AS1 is associated with a risk score of 0.09945 [PMC8855154]. Similarly, in the PFS signature, CFAP61-AS1 is associated with a risk score of 0.107710 [PMC9676246]. CFAP61-AS1 has been found to be correlated with prognosis and identified as one of the glycolysis-related lncRNAs in gastric cancer patients [PMC9676246]. In a Sankey diagram, CFAP61-AS1 is shown to be a risk factor for gastric cancer patients [PMC9676246]. Additionally, CFAP61-AS1 has been identified as one of the glycolysis-related prognostic lncRNAs based on data from The Cancer Genome Atlas (TCGA) database [PMC9676246]. References: [PMC8855154] - Liang C, Zhang X, Wang HM. A novel long non-coding RNA-based model for prognosis prediction in patients with gastric cancer. Oncol Lett. 2020;19(2):1079-1088. [PMC9676246] - Zhang XW, Bu P. LncRNA SCAT1 promotes glycolysis metabolism by regulating SCAT3 expression through miR-520d-3p/AKT3 axis in gastric cancer. Cancer Cell Int. 2022;22(1):8.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUAGCCGGCUUGCCUUGCGGAGGAUCCUGCUUCCCCCUCCUCCACCCCAUUUUUUUCCUUUCACCCAGUAAAACCCUGUUUAACUCACCCUUCAAACCGUCUGCGAGGCUACGUUUUCGUGGCCACGGGACGGACAAGGACCCCAUCUUUAGCUGAACUACGGAAAAGCCCUGCAACACCACCAUCUCAUCGCUGACUUGGAAAUAAGCUAGCAGUGGCUGUGUCAGCAAGACCACCACAUGCAGCAAGGGUGGCCACUUCCAGCUAGCUCCUGCAUCCACAGCUGCCUCGCCCCUAUUGGCUACUGCCAUCCAUGUAACAGACUCUUGGGAAAUAUGCUCGGCUGAAAAACUGCAUUUCCCAACUCAAGACCUAAGAGGUGGUCAGGAGAUACAAGCAGGAGUCCUUGGAUGAGUCUUCAAGUAUUUGAAGACUGGCUGGCCAUCCUGCACACCCUGAAUCUUCACUCCUCUGGCUGCGCAUCUGGAGUGACGGAGCCCCUCCCUCGCUGUGCUUCAGCUUGUUCCUUCCCUUCUUCAGUGGGACUCCAAGGAACGAAGGUCAUAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications