v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) CLDN10 antisense RNA 1 (CLDN10-AS1) URS000016D86A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CLDN10-AS1: CLDN10-AS1 is a differentially expressed long non-coding RNA (DElncRNA) that has been implicated in various aspects of lung adenocarcinoma (LUAD) [PMC5937496]. It has been shown to be upregulated in LUAD tissues [PMC8580341]. Additionally, CLDN10-AS1 has been found to be upregulated in LPS-treated human microvascular endothelial cells (HMECs) [PMC5632992]. CLDN10-AS1 has also been identified as a candidate lncRNA in atherosclerosis [PMC6389617]. It is associated with age, tumor stage, and lymphatic metastasis in LUAD patients [PMC5928764]. Furthermore, CLDN10-AS1 is involved in endothelial dysfunction and atherogenesis [PMC8556945]. Dysregulation of CLDN10-AS1 has also been reported in various types of cancers [PMC8556945]. In LUAD, CLDN10-AS1, along with SFTA1P and ADAMTS9-AS2, and their related mRNAs DLGAP5, E2F7, MCM7, RACGAP1, and RRM2 have prognostic value and may serve as biomarkers for the disease [PMC7053454]. Additionally, CLDN10-AS1 plays a role in the G1/S transition of the mitotic cell cycle through miR-125b-5p/PPAT regulation and regulates endothelium development through miR-125b-5p/CDH5 regulation [PMC7053454]. Furthermore, CLDN10-AS1 is associated with poor prognosis in LUAD patients [PMC7053454][PM9869594]. References: [PM9869594] [PM7053454] [PM5928764] [PM8556945] [PM6389617] [PM5632992] [PM8580341] [PMC5937496]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGGAGAGCCUGGCAGACAGAGCUCUGGGUAGAGUCUGGGUAGAGGGACCUGUGGUGGGAGAAAGAGAGAAGAUCAGAGUGGAGGGGAGAAGCAGGGUUGGGGCCUUGAAGGUACUGCUGAGCAUGUGGGUCCUUAUCCUUACCCUGCAUUGCCCGCAGGCCUGACCUUUGCUUCAUUCUUCAUGGCUGCCAAGUGAGAGUGUGGCCCCUGCAGAUGGUUGGAUCAUCCAUCCAGUUCUUUGCUUCCUCUAGCUGAUAUCCUUCUUUGCUGUACUAUAUGGGAAAAGCAAGAAAUAUUUGACACCAAAAUUGCUUCCUUUGUGUGGCCCCGUAUUGCCCUGUAUAGAAGCAUUUCGUCUUCACAACAACUCUAUGAGCAGUGUGAAGAUGGACUAAUACAAAGAGGAACUAGGGGAGCUUGGAGGAACCAGAGACUCAAUCAGGGAUUCAAGUGAAGUCUCUGUUGCAAACCCUUGAGCAGGUGAGAACCCCUGGACUCUUGCAGGGGAUGUGGGAGGAGCUGUACAUACAGACAGUGCUGUCCAGCCAAUGUGGGUUCAAACCCUGCAUCUGUCACUGGCUAUGUGACCUUGAUCAAGUUCCUUAAGGUCUCCAGGUUUGUUUUCUUAUCUGUAAGAUGAGAAUCCUCUUCUGCAAACCAUGUCUGUUUAAAAUAUGUGCUUAUUUUGAAAGUGAUGUAGCAACAUUUUCUCUAGUUAAUGUUCUUUCUCCCUCAUAAUUUUAAAACAUUUAUUCAUGACUAUAAUGUUAAGUCUGUGACUUUAUUUUUGCUAAAUGUCCAUCUCAGAGAAGAAUAUGACUUUAUAUAGCGAAGUAUUUUUUAAAAAAUAGCCUUAGUAAUGCAUAUUUGCAAUAAAAAUAUUUGACAAUCCUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications