Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Capra hircus (goat) chi-miR-30a-5p URS000016A0BF_9925

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCUCGACUGGAAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 37 other species

  1. Alligator mississippiensis (American alligator) ami-miR-30a-5p
  2. Anolis carolinensis Aca-Mir-30-P1b_5p (mature (guide))
  3. Bos taurus bta-miR-30a-5p
  4. Callithrix jacchus (white-tufted-ear marmoset) Callithrix_jacchus piRNA piR-cja-522984
  5. Callorhinchus milii Cmi-Mir-30-P1b_5p (mature (guide))
  6. Canis lupus familiaris Cfa-Mir-30-P1b_5p (mature (guide))
  7. Cavia porcellus cpo-miR-30a-5p
  8. Cervus elaphus (red deer) cel-miR-30a-5p
  9. Chrysemys picta bellii Cpi-Mir-30-P1b_5p (mature (guide))
  10. Columba livia cli-miR-30a-5p
  11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-30a-5p
  12. Daubentonia madagascariensis dma-miR-30a
  13. Drosophila erecta Drosophila_erecta piRNA piR-der-861414
  14. Drosophila melanogaster Drosophila_melanogaster piRNA piR-dme-21349674
  15. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-30-P1b_5p (mature (guide))
  16. Gallus gallus (chicken) Gga-Mir-30-P1b_5p (mature (guide))
  17. Gekko japonicus Gja-Mir-30-P1b_5p (mature (guide))
  18. Homo sapiens (human) Hsa-Mir-30-P1b_5p (mature (guide))
  19. Latimeria chalumnae Lch-Mir-30-P1b_5p (mature (guide))
  20. Macaca mulatta (Rhesus monkey) Mml-Mir-30-P1b_5p (mature (guide))
  21. Microcaecilia unicolor Mun-Mir-30-P1b_5p (mature (guide))
  22. Microcebus murinus (gray mouse lemur) mmr-miR-30a
  23. Monodelphis domestica Mdo-Mir-30-P1b_5p (mature (guide))
  24. Mus musculus (house mouse) Mmu-Mir-30-P1b_5p (mature (guide))
  25. Nomascus leucogenys nle-miR-30a
  26. Ophiophagus hannah oha-miR-30a-5p
  27. Ornithorhynchus anatinus Oan-Mir-30-P1b_5p (mature (guide))
  28. Oryctolagus cuniculus ocu-miR-30a-5p
  29. Otolemur garnettii (small-eared galago) oga-miR-30a
  30. Papio hamadryas (hamadryas baboon) pha-miR-30a
  31. Python bivittatus (Burmese python) pbv-miR-30a-5p
  32. Rattus norvegicus Rno-Mir-30-P1b_5p (mature (guide))
  33. Sarcophilus harrisii Sha-Mir-30-P1b_5p (mature (guide))
  34. Sphenodon punctatus (tuatara) Spt-Mir-30-P1b_5p (mature (guide))
  35. Taeniopygia guttata Tgu-Mir-30-P1b_5p (mature (guide))
  36. Xenopus laevis xla-miR-30a-5p
  37. Xenopus tropicalis Xtr-Mir-30-P1b_5p (mature (guide))
Publications