Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Microcebus murinus (gray mouse lemur) mmr-miR-30a URS000016A0BF_30608

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCUCGACUGGAAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 37 other species

  1. Alligator mississippiensis (American alligator) ami-miR-30a-5p
  2. Anolis carolinensis Aca-Mir-30-P1b_5p (mature (guide))
  3. Bos taurus bta-miR-30a-5p
  4. Callithrix jacchus (white-tufted-ear marmoset) Callithrix_jacchus piRNA piR-cja-522984
  5. Callorhinchus milii (elephant shark) Cmi-Mir-30-P1b_5p (mature (guide))
  6. Canis lupus familiaris (dog) Cfa-Mir-30-P1b_5p (mature (guide))
  7. Capra hircus chi-miR-30a-5p
  8. Cavia porcellus (domestic guinea pig) cpo-miR-30a-5p
  9. Cervus elaphus (red deer) cel-miR-30a-5p
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-30-P1b_5p (mature (guide))
  11. Columba livia cli-miR-30a-5p
  12. Dasypus novemcinctus dno-miR-30a-5p
  13. Daubentonia madagascariensis dma-miR-30a
  14. Drosophila erecta Drosophila_erecta piRNA piR-der-861414
  15. Drosophila melanogaster Drosophila_melanogaster piRNA piR-dme-21349674
  16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-30-P1b_5p (mature (guide))
  17. Gallus gallus (chicken) Gga-Mir-30-P1b_5p (mature (guide))
  18. Gekko japonicus Gja-Mir-30-P1b_5p (mature (guide))
  19. Homo sapiens Hsa-Mir-30-P1b_5p (mature (guide))
  20. Latimeria chalumnae Lch-Mir-30-P1b_5p (mature (guide))
  21. Macaca mulatta (Rhesus monkey) Mml-Mir-30-P1b_5p (mature (guide))
  22. Microcaecilia unicolor Mun-Mir-30-P1b_5p (mature (guide))
  23. Monodelphis domestica Mdo-Mir-30-P1b_5p (mature (guide))
  24. Mus musculus (house mouse) Mmu-Mir-30-P1b_5p (mature (guide))
  25. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-30a
  26. Ophiophagus hannah (king cobra) oha-miR-30a-5p
  27. Ornithorhynchus anatinus Oan-Mir-30-P1b_5p (mature (guide))
  28. Oryctolagus cuniculus (rabbit) ocu-miR-30a-5p
  29. Otolemur garnettii oga-miR-30a
  30. Papio hamadryas pha-miR-30a
  31. Python bivittatus (Burmese python) pbv-miR-30a-5p
  32. Rattus norvegicus Rno-Mir-30-P1b_5p (mature (guide))
  33. Sarcophilus harrisii Sha-Mir-30-P1b_5p (mature (guide))
  34. Sphenodon punctatus (tuatara) Spt-Mir-30-P1b_5p (mature (guide))
  35. Taeniopygia guttata Tgu-Mir-30-P1b_5p (mature (guide))
  36. Xenopus laevis xla-miR-30a-5p
  37. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-30-P1b_5p (mature (guide))