Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Malus domestica (apple) mdm-miR396g URS00001686B2_3750

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCACGGCUUUCUUGAACUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Ananas comosus (pineapple) microRNA 396f
  2. Asparagus officinalis aof-miR396a
  3. Cucumis melo cme-miR396e
  4. Cynara cardunculus var. scolymus cca-miR396e
  5. Eugenia uniflora eun-miR396a-5p
  6. Helianthus annuus ptc-miR396f
  7. Populus tomentosa Pto-miR396f
  8. Populus trichocarpa (black cottonwood) ptc-miR396f
Publications