Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Helianthus annuus (common sunflower) ptc-miR396f URS00001686B2_4232

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCACGGCUUUCUUGAACUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Ananas comosus microRNA 396f
  2. Asparagus officinalis aof-miR396a
  3. Cucumis melo cme-miR396e
  4. Cynara cardunculus var. scolymus cca-miR396e
  5. Eugenia uniflora (Brazil-cherry) eun-miR396a-5p
  6. Malus domestica (apple) mdm-miR396f
  7. Populus tomentosa Pto-miR396f
  8. Populus trichocarpa (black cottonwood) ptc-miR396f