Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-470-3p URS000016742D_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-470: Mmu-mir-470 is a validated miRNA that has been shown to be a potential candidate for protein Oct4, as it is in the same cluster as mmu-miR-203, 330, 342, 10a, and 99b [PMC3937077]. It has been experimentally validated and numerically validated by a TI model [PMC3937077]. In contrast to mmu-mir-470, other miRNAs such as mmu-let-7b and mmu-miR-181a have been experimentally validated for protein GCNF [PMC3937077]. For protein Nanog, the experimentally validated miRNAs are mmu-miR-134, mmu-mir-470, and mmu-miR-296 [PMC3937077]. Mmu-mir-470 shares the same seed sequence as miR-T1-3p [PMC5915558]. Additionally, bioinformatics analysis has shown that mmu-mir-470 targets TGIF1 in the regulation of TGF-beta signaling [PMC4499447]. On the other hand, miRNAs such as mmu-miR134 and mmu-miR21 have been found to inhibit genes related to pluripotency such as Nanog and Sox2 in cell differentiation processes [PMC9505168]. References: [PMC3937077] - TarBase database [PMC5915558] - Article on miRNA seed sequence analysis [PMC4499447] - Bioinformatics analysis of miRNA targets [PMC9505168] - Study on pluripotency genes regulation by miRNAs

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACCAGUACCUUUCUGAGAAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications