Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3074-5p URS0000166778_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3074: Hsa-mir-3074 is a microRNA that has been identified in breast cancer luminal B and has been associated with papillary renal cell carcinoma [PMC5123339]. However, its role in breast cancer is not yet known [PMC5123339]. Hsa-mir-3074, along with hsa-mir-25 and hsa-mir-106b, has been found to be involved in DNA damage response pathways [PMC9998480]. In prostate cancer, hsa-mir-3074 is one of the 22 upregulated microRNAs that can predict gene expression regulation [PMC8426106]. Hsa-mir-3074 has also been identified as a potential prognostic marker for esophageal adenocarcinoma [PMC6956414]. However, the function of hsa-mir-3074 in carcinogenesis is not well understood and requires further investigation [PMC6661144]. No target gene for hsa-mir-3074 has been predicted so far [PMC6661144]. In triple-negative breast cancer, hsa-miR-301b, hsa-miR-183, hsa-miR-18a, and hsa-miR-96 are upregulated compared to adjacent non-tumor tissue [PMC7499949]. Overall, the role of hsa-mir-3074 in different types of cancer is still being explored and further research is needed to fully understand its function and potential as a therapeutic target [PMC6661144].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUCCUGCUGAACUGAGCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications