Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) tRNA-Trp (anticodon CCA) 1-1 (TRW-CCA1-1) secondary structure diagram

Homo sapiens (human) tRNA-Trp (anticodon CCA) 1-1 (TRW-CCA1-1) URS00001618FC_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCCUCGUGGCGCAACGGUAGCGCGUCUGACUCCAGAUCAGAAGGUUGCGUGUUCAAAUCACGUCGGGGUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 111 other species

  1. Ailuropoda melanoleuca tRNA-Trp (CCA) (tRNA-Trp-CCA-4 1 to 3)
  2. Anguilla anguilla (European eel) tRNA-Trp
  3. Balaenoptera acutorostrata scammoni tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  4. Bos taurus tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1)
  5. Callithrix jacchus tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1, tRNA-Trp-CCA-2-2)
  6. Camelus ferus (Wild Bactrian camel) tRNA
  7. Canis lupus familiaris tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1)
  8. Carlito syrichta tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1)
  9. Cavia porcellus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1, tRNA-Trp-CCA-3-2)
  10. Ceratotherium simum simum tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  11. Chlorocebus sabaeus tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1, tRNA-Trp-CCA-4-2)
  12. Choloepus hoffmanni tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1)
  13. Cricetulus griseus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1, tRNA-Trp-CCA-3-2)
  14. Dipodomys ordii tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1, tRNA-Trp-CCA-3-2)
  15. Echinops telfairi tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1)
  16. Equus caballus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1, tRNA-Trp-CCA-3-2)
  17. Erinaceus europaeus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  18. Felis catus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  19. Fukomys damarensis tRNA
  20. Gadus morhua tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1, tRNA-Trp-CCA-2-2)
  21. Gorilla gorilla gorilla tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1)
  22. Haliotis rufescens tRNA-Trp
  23. Heterocephalus glaber tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1, tRNA-Trp-CCA-3-2)
  24. Ictidomys tridecemlineatus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1, tRNA-Trp-CCA-3-2)
  25. Loxodonta africana tRNA-Trp (CCA) (tRNA-Trp-CCA-5-1)
  26. Macaca mulatta tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1, tRNA-Trp-CCA-2-2)
  27. Marmota monax tRNA.Trp
  28. Mesocricetus auratus (golden hamster) tRNA
  29. Microcebus murinus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1, tRNA-Trp-CCA-3-2)
  30. Monodelphis domestica tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1)
  31. Mus caroli tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1, tRNA-Trp-CCA-4-2)
  32. Mus musculus castaneus tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1, tRNA-Trp-CCA-4-2)
  33. Mus musculus domesticus tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1, tRNA-Trp-CCA-4-2)
  34. Mus musculus musculus tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1, tRNA-Trp-CCA-4-2)
  35. Mus musculus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1, tRNA-Trp-CCA-3-2, tRNA-Trp-CCA-4 1 to 3)
  36. Mus pahari tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1, tRNA-Trp-CCA-4-2)
  37. Mus spretus tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1, tRNA-Trp-CCA-4-2)
  38. Neotoma lepida tRNA
  39. Nomascus leucogenys tRNA-Trp (CCA) (tRNA-Trp-CCA-5-1)
  40. Notamacropus eugenii tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1)
  41. Ochotona princeps tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  42. Ornithorhynchus anatinus tRNA-Trp (CCA) (tRNA-Trp-CCA-2 1 to 3)
  43. Oryctolagus cuniculus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  44. Otolemur garnettii tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  45. Ovis aries tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  46. Pangasianodon hypophthalmus tRNA-Trp
  47. Pan troglodytes tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1)
  48. Papio anubis tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1, tRNA-Trp-CCA-2-2)
  49. Petromyzon marinus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  50. Poecilia formosa tRNA
  51. Pongo abelii tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1)
  52. Procavia capensis tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1)
  53. Rattus norvegicus tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1, tRNA-Trp-CCA-4-2)
  54. Saimiri boliviensis boliviensis tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1, tRNA-Trp-CCA-2-2)
  55. Sarcophilus harrisii tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1)
  56. Sus scrofa tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  57. Trichechus manatus latirostris tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  58. Tupaia chinensis (Chinese tree shrew) tRNA
  59. Tursiops truncatus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  60. Vicugna pacos tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1, tRNA-Trp-CCA-3-2)
  61. Xiphophorus maculatus tRNA
2D structure Publications