Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Crenichthys baileyi tRNA-Trp secondary structure diagram

Crenichthys baileyi tRNA-Trp URS00001618FC_28760

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCCUCGUGGCGCAACGGUAGCGCGUCUGACUCCAGAUCAGAAGGUUGCGUGUUCAAAUCACGUCGGGGUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 64 other species

  1. Ailuropoda melanoleuca tRNA-Trp (CCA) (tRNA-Trp-CCA-4 1 to 3)
  2. Anguilla anguilla (European eel) tRNA-Trp
  3. Ataeniobius toweri tRNA-Trp
  4. Balaenoptera acutorostrata scammoni tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  5. Bos taurus tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1)
  6. Callithrix jacchus tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1, tRNA-Trp-CCA-2-2)
  7. Camelus ferus (Wild Bactrian camel) tRNA
  8. Canis lupus familiaris tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1)
  9. Carlito syrichta tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1)
  10. Cavia porcellus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1, tRNA-Trp-CCA-3-2)
  11. Ceratotherium simum simum tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  12. Characodon lateralis tRNA-Trp
  13. Chlorocebus sabaeus tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1, tRNA-Trp-CCA-4-2)
  14. Choloepus hoffmanni tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1)
  15. Cricetulus griseus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1, tRNA-Trp-CCA-3-2)
  16. Dipodomys ordii tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1, tRNA-Trp-CCA-3-2)
  17. Echinops telfairi tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1)
  18. Equus caballus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1, tRNA-Trp-CCA-3-2)
  19. Erinaceus europaeus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  20. Felis catus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  21. Fukomys damarensis (Damara mole-rat) tRNA
  22. Gadus morhua tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1, tRNA-Trp-CCA-2-2)
  23. Gorilla gorilla gorilla tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1)
  24. Haliotis rufescens (Red abalone) tRNA-Trp
  25. Heterocephalus glaber tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1, tRNA-Trp-CCA-3-2)
  26. Homo sapiens tRNA-Trp (anticodon CCA) 1-1 (TRW-CCA1-1)
  27. Ictidomys tridecemlineatus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1, tRNA-Trp-CCA-3-2)
  28. Loxodonta africana tRNA-Trp (CCA) (tRNA-Trp-CCA-5-1)
  29. Macaca mulatta tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1, tRNA-Trp-CCA-2-2)
  30. Marmota monax tRNA.Trp
  31. Mesocricetus auratus tRNA
  32. Microcebus murinus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1, tRNA-Trp-CCA-3-2)
  33. Monodelphis domestica tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1)
  34. Mus caroli tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1, tRNA-Trp-CCA-4-2)
  35. Mus musculus castaneus tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1, tRNA-Trp-CCA-4-2)
  36. Mus musculus domesticus tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1, tRNA-Trp-CCA-4-2)
  37. Mus musculus musculus tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1, tRNA-Trp-CCA-4-2)
  38. Mus musculus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1, tRNA-Trp-CCA-3-2, tRNA-Trp-CCA-4 1 to 3)
  39. Mus pahari tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1, tRNA-Trp-CCA-4-2)
  40. Mus spretus tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1, tRNA-Trp-CCA-4-2)
  41. Neotoma lepida (desert woodrat) tRNA
  42. Nomascus leucogenys tRNA-Trp (CCA) (tRNA-Trp-CCA-5-1)
  43. Notamacropus eugenii tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1)
  44. Ochotona princeps tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  45. Ornithorhynchus anatinus tRNA-Trp (CCA) (tRNA-Trp-CCA-2 1 to 3)
  46. Oryctolagus cuniculus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  47. Otolemur garnettii tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  48. Ovis aries tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  49. Pangasianodon hypophthalmus tRNA-Trp
  50. Pan troglodytes tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1)
  51. Papio anubis tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1, tRNA-Trp-CCA-2-2)
  52. Petromyzon marinus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  53. Poecilia formosa tRNA
  54. Pongo abelii tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1)
  55. Procavia capensis tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1)
  56. Rattus norvegicus tRNA-Trp (CCA) (tRNA-Trp-CCA-4-1, tRNA-Trp-CCA-4-2)
  57. Saimiri boliviensis boliviensis tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1, tRNA-Trp-CCA-2-2)
  58. Sarcophilus harrisii tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1)
  59. Sus scrofa tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  60. Trichechus manatus latirostris tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  61. Tupaia chinensis tRNA
  62. Tursiops truncatus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  63. Vicugna pacos tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1, tRNA-Trp-CCA-3-2)
  64. Xiphophorus maculatus tRNA
2D structure