ssc-mir-7: Ssc-mir-7 is a microRNA that is involved in various biological processes. It has a sequence of 5′UGGAAGACUAGUGAUUUUGUUGUU [PMC9659414]. The miRcute miRNA cDNA synthesis kit and primer sets were used for the quantification of ssc-mir-7 [PMC7112103]. It has been identified as a potential miRNA sponge for ssc-miR-127 and ssc-mir-7 [PMC7112103]. Knocking down the circRNA11: 19712163-19718631, which acts as a sponge for ssc-miR-127 and ssc-mir-7, resulted in an increase in the expression of ssc-miR-127 and ssc-mir-7 [PMC7112103]. Ssc-mir-7 has been found to be up-regulated in necrotic lung tissue compared to visually unaffected lung tissue of pigs infected with Actinobacillus pleuropneumoniae, suggesting its potential role during both viral and bacterial pulmonary infection in pigs [PMC5909910]. Ssc-mir-7 is one of the seven differentially expressed miRNAs that were chosen for validation by real-time RT-PCR in porcine hypothalamus and pituitary development [PMC3821617]. It has been found to be involved in the development of porcine hypothalamus [PMC3821617]. Ssc-mir-7 has also been predicted to have similar targets as PN-7–5p–1931, PN–125b–5p–19840, and miR–125b in hypothalamus, as well as PC–296–3p–8261, PC–296–3p–105798, miR145, and miR145–5p–335 in pituitary [PMC3821617]. Additionally, ssc-mir-7 has been identified as one of the highly expressed miRNAs in the anterior pituitary [PMC4489742]. It has been found to target IL-1β, IL-2, and TGF-β1 [PMC4778948].