v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-7 URS0000161522_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-miR-7: Bta-mir-7 is a microRNA that has been studied in various contexts. It has been shown to exhibit a trend in regulation in some studies [PMC5736867]. In addition, bta-mir-7 has been found to be differentially expressed between fresh and frozen sperm [PMC7214931]. It is also associated with important signaling pathways such as insulin and muscle development, as well as feed efficiency [PMC6244318]. Bta-mir-7 has been previously associated with adipose tissue and feed efficiency in bovine studies [PMC6244318]. Furthermore, bta-mir-7 is among the most abundant miRNAs found in development stages of cattle [PMC7073773]. In cattle-yak, the expression of bta-mir-7 is down-regulated, suggesting its involvement in reproductive processes and male sterility [PMC9581192]. The target genes of bta-mir-7 include MYRFL, FANCA, INSL3, USP9X, and SHF [PMC9581192]. The expression levels of bta-miR-449a and its target genes FANCA, MYRFL, and SHF have also been validated using qPCR [PMC9581192]. Bta-mir-7 has also been used as a positive control for normalization purposes in some studies [PMC6785219]. Overall, bta-mir-7 is involved in various signaling pathways and plays important roles in reproductive processes and male sterility. It is also used as a reference for normalization purposes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGAAGACUAGUGAUUUUGUUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 71 other species

  1. Acyrthosiphon pisum (pea aphid) api-miR-7
  2. Aedes aegypti Aae-Mir-7_5p (mature (guide))
  3. Alligator mississippiensis Ami-Mir-7-P2_5p (mature (guide))
  4. Anolis carolinensis (green anole) Aca-Mir-7-P1_5p (mature (guide))
  5. Bactrocera dorsalis (oriental fruit fly) bdo-miR-7
  6. Blattella germanica (German cockroach) Bge-Mir-7_5p (mature (guide))
  7. Bombyx mori (domestic silkworm) Bombyx_mori piRNA piR-bmo-12852
  8. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-7
  9. Callorhinchus milii (elephant shark) Cmi-Mir-7-P2_5p (mature (guide))
  10. Canis lupus familiaris (dog) Cfa-Mir-7-P1_5p (mature (guide))
  11. Capra hircus chi-miR-7-5p
  12. Cavia porcellus cpo-miR-7-5p
  13. Cervus elaphus (red deer) cel-miR-7
  14. Chiloscyllium plagiosum microRNA cpl-miR-7
  15. Ciona intestinalis Cin-Mir-7_5p (mature (guide))
  16. Columba livia (rock pigeon) cli-miR-7a-5p
  17. Crassostrea gigas Cgi-Mir-7_5p (mature (guide))
  18. Cyprinus carpio (common carp) ccr-miR-7a
  19. Danio rerio Dre-Mir-7-P1b_5p (mature (guide))
  20. Daphnia magna Dma-Mir-7_5p (mature (guide))
  21. Daphnia pulex Dpu-Mir-7-P10_5p (mature (guide))
  22. Dasypus novemcinctus (nine-banded armadillo) dno-miR-7-5p
  23. Dinoponera quadriceps dqu-miR-7-5p
  24. Drosophila ananassae Dan-Mir-7_5p (mature (guide))
  25. Drosophila erecta Drosophila_erecta piRNA piR-der-819708
  26. Drosophila melanogaster (fruit fly) Dme-Mir-7_5p (mature (guide))
  27. Drosophila mojavensis Dmo-Mir-7_5p (mature (guide))
  28. Drosophila simulans Dsi-Mir-7_5p (mature (guide))
  29. Drosophila virilis dvi-miR-7-5p
  30. Drosophila yakuba Dya-Mir-7_5p (mature (guide))
  31. Echinops telfairi Ete-Mir-7-P2_5p (mature (co-guide))
  32. Eptatretus burgeri Ebu-Mir-7-P5_5p (mature (guide))
  33. Gadus morhua (Atlantic cod) gmo-miR-7a-5p
  34. Gallus gallus Gga-Mir-7-P2c_5p (mature (guide))
  35. Gekko japonicus Gja-Mir-7-P2_5p (mature (co-guide))
  36. Heliconius melpomene Hme-Mir-7_5p (mature (guide))
  37. Homo sapiens hsa-miR-7-5p
  38. Hyalella azteca miR-7a
  39. Ixodes scapularis (black-legged tick) Isc-Mir-7_5p (mature (guide))
  40. Latimeria chalumnae Lch-Mir-7-P1_5p (mature (guide))
  41. Lepisosteus oculatus Loc-Mir-7-P1_5p (mature (guide))
  42. Lingula anatina Lan-Mir-7_5p (mature (guide))
  43. Lottia gigantea lgi-miR-7
  44. Macaca mulatta Mml-Mir-7-P1_5p (mature (guide))
  45. Manduca sexta (tobacco hornworm) mse-miR-7
  46. Maylandia zebra mze-miR-7a
  47. Microcaecilia unicolor Mun-Mir-7-P1f_5p (mature (guide))
  48. Monodelphis domestica Mdo-Mir-7-P2_5p (mature (co-guide))
  49. Monopterus albus (swamp eel) Mal-Mir-7-P3_5p (mature (guide))
  50. Mus musculus Mmu-Mir-7-P1_5p (mature (guide))
  51. Nautilus pompilius Npo-Mir-7_5p (mature (guide))
  52. Ophiophagus hannah oha-miR-7-5p
  53. Ornithorhynchus anatinus (platypus) Oan-Mir-7-P1_5p (mature (guide))
  54. Oryctolagus cuniculus ocu-miR-7a-5p
  55. Penaeus japonicus miR-7
  56. Petromyzon marinus Pma-Mir-7-o1_5p (mature (guide))
  57. Polistes canadensis pca-miR-7-5p
  58. Pteropus alecto pal-miR-7b-5p
  59. Python bivittatus pbv-miR-7-5p
  60. Rattus norvegicus (Norway rat) Rno-Mir-7-P1_5p (mature (guide))
  61. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-7-P2_5p (mature (co-guide))
  62. Scyliorhinus torazame (cloudy catshark) Sto-Mir-7-P1_5p (mature (guide))
  63. Sphenodon punctatus (tuatara) Spt-Mir-7-P1_5p (mature (guide))
  64. Sus scrofa (pig) ssc-miR-7-5p
  65. Taeniopygia guttata Tgu-Mir-7-P1_5p (mature (guide))
  66. Tetranychus urticae (two-spotted spider mite) tur-miR-7-5p
  67. Tribolium castaneum (red flour beetle) Tca-Mir-7_5p (mature (guide))
  68. Triops cancriformis tcf-miR-7
  69. Tupaia chinensis (Chinese tree shrew) tch-miR-7-5p
  70. Xenopus laevis Xla-Mir-7-P3b_5p (mature (guide))
  71. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-7-P1_5p (mature (guide))
 Publications