Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tupaia chinensis (Chinese tree shrew) tch-miR-7-5p URS0000161522_246437

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAAGACUAGUGAUUUUGUUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 128 other species

  1. Acyrthosiphon pisum (pea aphid) api-miR-7
  2. Aedes aegypti (yellow fever mosquito) Aae-Mir-7_5p (mature (guide))
  3. Alligator mississippiensis (American alligator) Ami-Mir-7-P2_5p (mature (guide))
  4. Anolis carolinensis (green anole) Aca-Mir-7-P1_5p (mature (guide))
  5. Bactrocera dorsalis bdo-miR-7
  6. Blattella germanica Bge-Mir-7_5p (mature (guide))
  7. Bombyx mori Bombyx_mori piRNA piR-bmo-12852
  8. Bos taurus (cattle) bta-miR-7
  9. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-7
  10. Callorhinchus milii (elephant shark) Cmi-Mir-7-P2_5p (mature (guide))
  11. Canis lupus familiaris Cfa-Mir-7-P1_5p (mature (guide))
  12. Capra hircus chi-miR-7-5p
  13. Cavia porcellus (domestic guinea pig) cpo-miR-7-5p
  14. Cervus elaphus (red deer) cel-miR-7
  15. Chiloscyllium plagiosum microRNA cpl-miR-7
  16. Ciona intestinalis (vase tunicate) Cin-Mir-7_5p (mature (guide))
  17. Columba livia (rock pigeon) cli-miR-7a-5p
  18. Crassostrea gigas (Pacific oyster) Cgi-Mir-7_5p (mature (guide))
  19. Cyprinus carpio ccr-miR-7a
  20. Danio rerio (zebrafish) Dre-Mir-7-P1b_5p (mature (guide))
  21. Daphnia magna Dma-Mir-7_5p (mature (guide))
  22. Daphnia pulex (common water flea) Dpu-Mir-7-P10_5p (mature (guide))
  23. Dasypus novemcinctus dno-miR-7-5p
  24. Dinoponera quadriceps dqu-miR-7-5p
  25. Drosophila ananassae Dan-Mir-7_5p (mature (guide))
  26. Drosophila erecta Drosophila_erecta piRNA piR-der-819708
  27. Drosophila melanogaster (fruit fly) Dme-Mir-7_5p (mature (guide))
  28. Drosophila mojavensis Dmo-Mir-7_5p (mature (guide))
  29. Drosophila simulans Dsi-Mir-7_5p (mature (guide))
  30. Drosophila virilis dvi-miR-7-5p
  31. Drosophila yakuba Dya-Mir-7_5p (mature (guide))
  32. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-7-P2_5p (mature (co-guide))
  33. Eptatretus burgeri Ebu-Mir-7-P5_5p (mature (guide))
  34. Gadus morhua (Atlantic cod) gmo-miR-7a-5p
  35. Gallus gallus (chicken) Gga-Mir-7-P2c_5p (mature (guide))
  36. Gekko japonicus Gja-Mir-7-P2_5p (mature (co-guide))
  37. Heliconius melpomene Hme-Mir-7_5p (mature (guide))
  38. Homo sapiens (human) hsa-miR-7-5p
  39. Hyalella azteca miR-7a
  40. Ixodes scapularis Isc-Mir-7_5p (mature (guide))
  41. Latimeria chalumnae Lch-Mir-7-P1_5p (mature (guide))
  42. Lepisosteus oculatus (spotted gar) Loc-Mir-7-P1_5p (mature (guide))
  43. Lingula anatina Lan-Mir-7_5p (mature (guide))
  44. Lottia gigantea (owl limpet) lgi-miR-7
  45. Macaca mulatta (Rhesus monkey) Mml-Mir-7-P1_5p (mature (guide))
  46. Manduca sexta mse-miR-7
  47. Maylandia zebra (zebra mbuna) mze-miR-7a
  48. Microcaecilia unicolor Mun-Mir-7-P1f_5p (mature (guide))
  49. Monodelphis domestica Mdo-Mir-7-P2_5p (mature (co-guide))
  50. Monopterus albus (swamp eel) Mal-Mir-7-P3_5p (mature (guide))
  51. Mus musculus Mmu-Mir-7-P1_5p (mature (guide))
  52. Nautilus pompilius Npo-Mir-7_5p (mature (guide))
  53. Ophiophagus hannah (king cobra) oha-miR-7-5p
  54. Ornithorhynchus anatinus (platypus) Oan-Mir-7-P1_5p (mature (guide))
  55. Oryctolagus cuniculus (rabbit) ocu-miR-7a-5p
  56. Penaeus japonicus miR-7
  57. Petromyzon marinus Pma-Mir-7-o1_5p (mature (guide))
  58. Polistes canadensis pca-miR-7-5p
  59. Pteropus alecto (black flying fox) pal-miR-7b-5p
  60. Python bivittatus (Burmese python) pbv-miR-7-5p
  61. Rattus norvegicus (Norway rat) Rno-Mir-7-P1_5p (mature (guide))
  62. Sarcophilus harrisii Sha-Mir-7-P2_5p (mature (co-guide))
  63. Scyliorhinus torazame Sto-Mir-7-P1_5p (mature (guide))
  64. Sphenodon punctatus (tuatara) Spt-Mir-7-P1_5p (mature (guide))
  65. Sus scrofa (pig) ssc-miR-7-5p
  66. Taeniopygia guttata (zebra finch) Tgu-Mir-7-P1_5p (mature (guide))
  67. Tetranychus urticae tur-miR-7-5p
  68. Tribolium castaneum Tca-Mir-7_5p (mature (guide))
  69. Triops cancriformis tcf-miR-7
  70. Xenopus laevis Xla-Mir-7-P3b_5p (mature (guide))
  71. Xenopus tropicalis Xtr-Mir-7-P1_5p (mature (guide))
Publications